Variation Information: n4109

Namen4109 View on WormBase
Species C. elegans
Genetic positionV:0.13 +/- 0.000 cM
Genomic positionV: 6665218..6665955
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
VT1362 mir-70(n4109) V. C. elegans Deletion breakpoints are: ATTCATATTTCGATTAATAAAATTACCAAACA / CAATCCAACATAA...ATGGATACGCAGTA / AGAACAATATATGAACGATCGAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.