Variation Information: gk1252

Namegk1252 View on WormBase
Species C. elegans
Genetic positionII:-14.04 +/- 0.003 cM
Genomic positiongenomic coordinates unknown or not listed
Protein changeprotein change unknown or not listed

Strains carrying this variation

Strain Genotype Species Description
VC2914 C40D2.4(gk1252) II; Y102A11A.2(gk3151) X. C. elegans C40D2.4, Y102A11A.2. The gk1252 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 547 bp. Deletion left flank: AAATTGCAATCGCTTCCGGTAAAATTACTT. Deletion right flank: GTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATA TGTATATGTATATGTATATGTATATGTATATGTATATGTTTATGTATATGTATATGTAT ATGTAAATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTA TATGTATATGTATATGTATATGCTGAAAGTCGA. The gk3151 allele was identifed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807