Variation Information: gk1160

Namegk1160 View on WormBase
Species C. elegans
Genetic positionIII:-2.45 +/- 0.000 cM
Genomic positionIII: 4818172..4818297
Protein changeF26A1.4 F26A1.7a Deletion

Strains carrying this variation

Strain Genotype Species Description
VC2475 M04C7.4(gk3034) I; F26A1.4(gk1160) III. C. elegans F26A1.4, M04C7.4. The allele gk1160 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTTAGGTCTGGCACTACCCG. External right primer: AAAACATTGACACACCTGCG. Internal left primer: AAAGCGGCAGCAGTTAAGAA. Internal right primer: CTACCGGTACTGCCATTCGT. Internal WT amplicon: 1327 bp. Deletion size: 126 bp. Deletion left flank: TCACGGATCGGACTCTTTACCGTGCAATGG. Deletion right flank: TTTTTTAAATTGAAAATGCGAGCATCTAGG. The allele gk3034 was identified by CGH but not confirmed by PCR. Left flanking probe: GTACGGTAAGTTGGCCGAGTTGCATTATTCGTCTCGTTCAAGAGGATAAC. Right flanking probe: CAGGCACGCAGGCGCATCTGCACGTACCATGGCTACTTTAGCTGATGAAC. Left deleted probe: GATTTTATCAGCATACGGGCTCGTAAAAGAGAAGAGGAGACGAGGTTACG. Right deleted probe: CTGTGGCTGCTGTTCCAAATGCCAATCTGGAAATGGGAATTTCGGTAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807