Variation Information: gk1133

Namegk1133 View on WormBase
Species C. elegans
Genetic positionV:4.99 +/- 0.000 cM
Genomic positionV: 13225835..13226176
Protein changeC34D1.1 Deletion

Strains carrying this variation

Strain Genotype Species Description
VC2344 C34D1.1(gk1133) B0462.4(gk3031) V. C. elegans C34D1.1, B0462.4. The allele gk1133 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 337 bp. Deletion left flank: TTTTTTTCAGATATTTAGGTTAGTCCACTT. Deletion right flank: GGGCACGCCCACTTTATACTATTTTGATGT. Insertion Sequence: TAT. The allele gk3031 was identified by CGH and not confirmed by PCR. Left flanking probe: TTATAAACAGAGACAAATTTAGACCAAAACTCTGTAGGAAAGTGAGTTTT. Right flanking probe: ACAGGAATATGAATTGAGTGATTGCTTGTGGTAGACTCTGTAGATGGTCT. Left deleted probe: AAGTGAGTTTTTCCGTGTGTTCTGTGGGATCAGGTGCTCCAAATCTTCCA. Right deleted probe: GCGCCAATGCTAATATTATACTTATATAAAAGCACTTAACAAGCTGAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807