Variation Information: ok2420

Nameok2420 View on WormBase
Species C. elegans
Genetic positionII:-0.95 +/- 0.001 cM
Genomic positionII: 5751387..5753845
Protein changeF10C1.7a F10C1.7c F10C1.7e Deletion

Strains carrying this variation

Strain Genotype Species Description
VC1832 ifb-2(ok2420)/mIn1 [mIs14 dpy-10(e128)] II. C. elegans F10C1.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2420 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACTCTGCTCCTGCTTTGCAT. External right primer: CCGAGTTATCGTGACCCACT. Internal left primer: AGCAGTGGGAGTGCAAGACT. Internal right primer: ACGTCGAATGATTTTGGGAG. Internal WT amplicon: 3175 bp. Deletion size: 2459 bp. Deletion left flank: TGAGGATCGTAACAAGGAGCTTGTGATTGA. Deletion right flank: ACCACCAGACTCAATTGTGATGGAATCTCA. Insertion Sequence: TATTGAAAACTTTTCAGGGTGATATTCCCAGTCTTCTTCAACAAGCTTCACCTCCAGGA GGAGTTAAATCTCCATCAGCTGTAGTATTTCCGCCTGTTTCCGCAGCTGTCGCTGCAAT CACTGAAATTTCTCCACAAAGTAGCTACTCATCAATTGTGCCAAAAGTGGAAACCGATC AAATCTCCCAACAACTATTTAAATGTTAGTTTTTTATGCGATACAATTATTGCATCAAA CTAATTTTCTCATGTTTCCAGCTCTTCCTTTGTGGTCATTCCAACAAACTCCTGGATTA CCTATCGGAATGGATCTATCACAACTTGTTTTCCAACAATCCTCTCCCGACAAAACAGT TTCACCTGTGAAATCAGAAGTTGTAGAAGAAACGAAACCAATCGCTTCTTCACAATTAA CACTTCACAGCTTCTCCGCATATGTCAAATGTAATAAGACAAGTTTAAGGACAGAACTC GTGAAGATTGAGAATACACTGGAAAAAGATGATATTGACATTTCTGTATTTTACGAAAA ATATCCGAAATTACTTCGAGAATTGTTCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807