Variation Information: gk908

Namegk908 View on WormBase
Species C. elegans
Genetic positionII:0.89 +/- 0.003 cM
Genomic positionII: 8774374..8774374
Protein changeK08F8.6 Substitution

Strains carrying this variation

Strain Genotype Species Description
VC10110 let-19(gk908) unc-4(e120) II. C. elegans K08F8.6. Unc. External left primer: TCAATGCCTGGAGATGATGA. External right primer: CCCGCCTTCTTTATCTGTTG. External WT amplicon: 434 bp. This strain carries a point mutation in K08F8.6. The mutation is gk908, which is a G->A mutation at K08F8 coordinate 36647 (flanking sequences AATGGTTGAAGAAAGCAAGAAGGAAAGTTA and CAAACAACAGATAAAGAAGGCGGGGCAGTA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807