Variation Information: dd18
Name | dd18 View on WormBase |
---|---|
Species | C. elegans |
Genetic position | IV:6.03 +/- 0.000 cM |
Genomic position | IV: 12568259..12569297 |
Protein change | K08E7.3 Deletion |
Strains carrying this variation
Strain | Genotype | Species | Description |
---|---|---|---|
TH113 | let-99(dd18) IV/nT1 [qIs51] (IV;V). | C. elegans | let-99(dd18) contains a 1039bp deletion with the flanking sequences TTTGGATGAGTTGAAGCATCCCAAGCCCCG / ATGAATGCTCTCTTATTGTTAATCTCCTCT. The deletion starts behind the DEP domain. Heterozygotes are GFP+ in the pharynx. dd18 is a maternal effect lethal mutation. |