Variation Information: dd17
| Name | dd17 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | IV:6.02 +/- 0.000 cM |
| Genomic position | IV: 12567754..12568400 |
| Protein change | K08E7.3 Deletion |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| TH112 | let-99(dd17) IV/nT1 [qIs51] (IV;V). | C. elegans | let-99(dd17) contains a 647bp deletion with the flanking sequences aatttttaggaagtttccagaaatttttcc / CAAGGCTCCCACGAAGATTATCGCGATCTA. The deletion removes the N terminus of the open reading frame including the start codon and the DEP domain. Heterozygotes are GFP+ in the pharynx. dd17 is a maternal effect lethal mutation. |