Variation Information: bn126
| Name | bn126 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | III:21.21 +/- 0.001 cM |
| Genomic position | genomic coordinates unknown or not listed |
| Protein change | Deletion |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| SS746 | klp-19(bn126)/mT1 [dpy-10(e128)] III. | C. elegans | Heterozygotes are WT and segregate WT, Dpys (mT1 homozygotes) and L1 lethals (bn126 homozygotes). klp-19 deletion is 435 bases between TTCACAGTGTTCGTGGAGAA and GCAAGGAATCGCGCCGGCT. klp-19 deletion is lethal over hT2. |