Variation Information: ok2042

Nameok2042 View on WormBase
Species C. elegans
Genetic positiongenetic position unknown or not listed
Genomic positionII: 14308064..14309483
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
RB1653 ctl-3(ok2042) II. C. elegans Y54G11A.13. Homozygous. Outer Left Sequence: CGGCGATTCTTATACTCCCA. Outer Right Sequence: CTTCCCCACATGGTCAATCT. Inner Left Sequence: GGCCAATTTTCTGCCTGATA. Inner Right Sequence: CAACTGCTTTCGCATGGTTA. Inner Primer PCR Length: 2912 bp. Deletion Size: 1420 bp. Deletion left flank: CATTTCCGAAATCCGGATGAACTTTCGTGAACTCTTTGACCATTCCATTTTGAATTTCC TCCAAACAGCCACCCAAATCACTAGCCAAATTCCCAACGAGCCGATCTCTCTCCTCCTC CTTGAGCACTTTCTCCCAGAACTGACGTGGCTGCTCGTAGTTGTGATCGTCTCCAGT. Deletion right flank:  ATGGATTGAACTCCCATTTCTCAGCTTGTTCGAATGTCATCACTTGAATGAACATCTTC CATTCCGGGAAATTTCTTGACTCAATGGCATTGAACAGGTCGCGGATCGCATAGTCTGG ATCCGAAGAGGCGAGCTTTCCAGCGTCAGTTGGATCGAGATTCTTGGAACCTTGAGCAG GCTGAAAAATAGAAAATGAAAATTTAATTCTAGTCCCCGTCTCTCTTAGGCTTACCTTG . Insertion Sequence: GGATTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807