Variation Information: ok1388

Nameok1388 View on WormBase
Species C. elegans
Genetic positionX:1.44 +/- 0.004 cM
Genomic positionX: 9694968..9695824
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
RB1289 C43C3.2(ok1388) X. C. elegans C43C3.2 Homozygous. Outer Left Sequence: catacccaagtacgcgtgaa. Outer Right Sequence: tgaaagtcaactggtggcag. Inner Left Sequence: ccacgtcgcctgttaagttt. Inner Right Sequence: acagttgcagaagcgagaca. Inner Primer PCR Length: 2850. Estimated Deletion Size: about 900 bp. Breakpoint data provided by Neline Kriek 10/2004: AAGTCANCACTGGAATGCATCTGTATAAGTGTGTCGATGATCTTGGTCGCGAGTTGTTT GTTGTATTTACTTTGTACTbreakpointACGACGAACACCCGACCTGAATATAGCGAG CTAATCGCAATACGTAAGTTGTTATCATTCAAGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807