Variation Information: ok1052

Nameok1052 View on WormBase
Species C. elegans
Genetic positionIII:-4.25 +/- 0.000 cM
Genomic positionIII: 3880363..3882321
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
RB1085 tir-1(ok1052) III. C. elegans F13B10.1a Homozygous. Outer Left Sequence: GCAATCAAAGTTTCCAGCGT. Outer Right Sequence: CCTTGTCCTACTCAGCCAGC. Inner Left Sequence: AGATAAAGTCGGCAACCTGC. Inner Right Sequence: CAAATGGCGATCTGTACCCT. Inner Primer PCR Length: 3224. Estimated Deletion Size: about 1900 bp. From Nathalie Pujol 11/04: breakpoints, with a 8 bases insertion, AAATGTCGCCGGATCGTGAACTTGCAAGAAT/AGAATAAA/TGTAGACAGTGCTGGCGT AATTCGCCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807