Variation Information: n4568

Namen4568 View on WormBase
Species C. elegans
Genetic positionX:24.43 +/- 0.000 cM
Genomic positionX: 17595085..17595741
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
MT18016 nDf63 III; mir-63(n4568) X. C. elegans Both deletions are homozygous by PCR. mir-63, mir-229, mir-64, mir-65, and mir-66 are related in sequence. nDf63 removes mir-229, mir-64, mir-65, and mir-66. nDf63 was outcrossed 6x; n4568 has been outcrossed 2x. Reference: Curr Bio (2010) doi:10.1016/j.cub.2009.12.051.
VT1289 mir-63(n4568) X. C. elegans Deletion breakpoints are: TAAAAATTCAAAGAATTGATATCTGAACA / CTACTATGCCACC...CCAAAGGGGTGG / TTTTCAACAATTTCACCACTGGCGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.