Variation Information: n4983

Namen4983 View on WormBase
Species C. elegans
Genetic positionX:-12.66 +/- 0.000 cM
Genomic positionX: 3006121..3006855
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
MT16848 mir-249(n4983) X. C. elegans Deletion breakpoints are:TGCCAACTGGATTGAACAAAACAACT / TGCACACAAGAGAGAGGTCCACCTAGCAA...AGATAAGTCGTACATCACTTTAT / CTGTTTAATGGATTAGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.