Variation Information: n4618

Namen4618 View on WormBase
Species C. elegans
Genetic positionII:4.07 +/- 0.000 cM
Genomic positionII: 11832923..11834028
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
MT16316 mir-355(n4618) II. C. elegans Deletion breakpoints are:TGTGTCTATGAAATTAATTC / TTATATCAACTCTAATTAT...TTTTGGGAAAATGAAC / GATTAAACATTTTTTTTA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.