| MT16309 |
mir-247&mir-797(n4505) X. |
C. elegans |
Deletion breakpoints are: CCAGTGTTACCACCGCTTGCTACAAACGGC / AAAAAATTTGAA...CAAAAATTTAT / CACATGAAATTATACCAAACAGTCAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| MT17431 |
nDf49 II; nDf59 V; mir-247(n4505) X. |
C. elegans |
mir-44, mir-61, and mir-247 are members of the mir-44 family. mir-45 is also part of this family, but is not deleted in thsi strain; it is closely linked to mir-44. Reference: Curr Bio (2010) 20:367-73. |
| MT17676 |
mir-45(n4280) II; nDf59 V; mir-247(n4505) X. |
C. elegans |
nDf59 removes mir-61 and mir-250. mir-6, mir-247, and mir-45 are related in sequence. Reference: Curr Bio (2010) 20:367-73. |
| MT17848 |
mir-2(n4108) I; nDf49 II; nDf59 V; mir-247(n4505) X. |
C. elegans |
mir-2 family and most of mir-44 family are removed in this strain (mir-45 is present). Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73. |