Variation Information: n4636

Namen4636 View on WormBase
Species C. elegans
Genetic positionIV:4.76 +/- 0.000 cM
Genomic positionIV: 10939700..10940217
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
MT15020 mir-246(n4636) IV. C. elegans Deletion breakpoints are:GATACATCGGTGCAATGAAGA / CATCATCAGATAATATTCTCAA...ATGTTTCGGGTAGGAGCTGT / TCAAACTTTGGACATTGGCATC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.