Variation Information: n4635

Namen4635 View on WormBase
Species C. elegans
Genetic positionX:-4.07 +/- 0.000 cM
Genomic positionX: 5918342..5919648
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
MT15018 mir-360(n4635) X. C. elegans Deletion breakpoints are:ACGTGCTGTAAAAATTTGCGG / ATACCAAGCCTACAGTTGATTT...GGGACTTTGGGCGGCTTA / AAGTGTCACTGGTCTGGACG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.