| MT14767 |
mir-54&mir-55(nDf58) X. |
C. elegans |
Deletion breakpoints are: GAATGTTCACTGAGCTCTACATCATTG / TTCAAACAGTTT...AAGTTGTGATCTAC / AATTATCTTTGGATTTTTAATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| MT17136 |
nDf67 IV; nDf58 X. |
C. elegans |
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73. |
| MT17137 |
mir-51(n4473) IV; nDf58 X. |
C. elegans |
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73. |
| MT17143 |
nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X. |
C. elegans |
Heterozygote. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Curr Bio (2010) 20:367-73. |
| MT17446 |
mir-53(n4113) mir-52(n4100) IV; nDf58 X. |
C. elegans |
Slow growing. Some larval and adult lethality. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73. |