Variation Information: n4548
| Name | n4548 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | V:12.80 +/- 0.000 cM |
| Genomic position | V: 17139973..17140757 |
| Protein change | Deletion |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| MT14682 | mir-257(n4548) V. | C. elegans | Deletion breakpoints are:GACCTTGGACTTCAGCACATCCGGTTTTCCA / CTCGGAACTTGACG....CCTGCAGTTCTTCCAT / GATGTACTCAGGGCCTTTAATTTTGTACATGCTCCATAGGAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |