Variation Information: n4382

Namen4382 View on WormBase
Species C. elegans
Genetic positionIV:1.86 +/- 0.000 cM
Genomic positionIV: 5561640..5562665
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
MT14446 mir-228(n4382) IV. C. elegans Deletion breakpoints are: GTACACAGAACAATAGAAATCGCCT / CGTTTCTGTTT...CTACGATATTAT / GTCCGAATTAAATTGCTTTTTTTTTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.