Variation Information: n4113
| Name | n4113 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | IV:4.79 +/- 0.000 cM |
| Genomic position | IV: 11026893..11027697 |
| Protein change | Deletion |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| MT12989 | mir-53(n4113) IV. | C. elegans | Deletion breakpoints are: ACTCTATGATGTCCTTCAAAACAACA / TAATTTACGCCAT...CAGAATCGGGAGAAA / TTTATAATAATAGAGAGAGAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| MT17446 | mir-53(n4113) mir-52(n4100) IV; nDf58 X. | C. elegans | Slow growing. Some larval and adult lethality. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73. |