| MT12983 |
mir-238(n4112) III. |
C. elegans |
Deletion breakpoints are: ACAACTTAATATCTTTTCTGGTCATTTTCAA / TACTTACCTCA...AGGTGACAGAAA / GTTGTGTGAAAATGACAAATATCTCTTTTCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| MT16061 |
mir-238(n4112) III; nDf62 X. |
C. elegans |
4x outcrossed autosomes; 2x outcrossed X chromosome. Homozygous by PCR. Reference: Curr Bio (2010) 20:367-73. |