Variation Information: n4106

Namen4106 View on WormBase
Species C. elegans
Genetic positionV:2.58 +/- 0.000 cM
Genomic positionV: 10538727..10539255
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
MT12969 mir-259(n4106) V. C. elegans Deletion breakpoints are: GATTATAATGCAAACAACCTGGGGGATC / CAGTATCTTCA...AAGAGCGAAAGT / ACAGTCTCCTCCTTCTTTGCTCACTTCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT2905 mir-259(n4106) V; mir-34(gk437) X. C. elegans DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT2906 mir-83(n4638) IV; mir-259(n4106) V; mir-34(gk437) X. C. elegans DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3032 mir-83(n4638) IV; mir-259(n4106) V. C. elegans DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.