Caenorhabditis Genetics Center (CGC)

Variation Information: n4102

Namen4102 View on WormBase
Species C. elegans
Genetic positionI:0.87 +/- 0.000 cM
Genomic positionI: 6172323..6173144
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
MT12955 mir-1(n4102) I. C. elegans Deletion breakpoints are:CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT17810 mir-1(n4102) I. C. elegans Deletion breakpoints are: CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.