Caenorhabditis Genetics Center (CGC)

Variation Information: n4638

Namen4638 View on WormBase
Species C. elegans
Genetic positionIV:3.49 +/- 0.000 cM
Genomic positionIV: 7841244..7842066
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
KB11 mir-83(n4638) IV. C. elegans MT15501 mir-83(n4638) was outcrossed 6x to produce this strain. Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
KB12 mir-67(n4899) III; mir-83(n4638) IV. C. elegans Combination mutant made with 6x outcrossed lines KB10 mir-67(n4899) and KB11 mir-83(n4638).
MT15022 mir-83(n4638) IV. C. elegans Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15501 mir-83(n4638) IV. C. elegans Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT2595 mir-83(n4638) IV; mir-34(gk437) X. C. elegans DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT2797 pat-3(st564)/qC1 [dpy-19(e1259) glp-1(q339)] III; mir-83(n4638) IV; mir-34(gk437) X. C. elegans Heterozygotes are superficially WT (with DTC migration defects), and segregate superficially WT (with DTC migration defects), sterile ts-Dpy qC1 homozygotes, and st564 homozygotes (PAT lethal). Pick WT and check for correct segregation of progeny to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT2812 unc-54(e190) I; mir-83(n4638) IV; mir-34(gk437) X. C. elegans Paralyzed. DTC migration defect. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT2885 cdc-42(gk388)/mIn1 [mIs14 dpy-10(e128)] II; mir-83(n4638) IV; mir-34(gk437) X. C. elegans Heterozygotes are superficially WT (DTC migration defects) with relatively dim pharyngeal GFP signal, and segregate superficially WT (DTC migration defects) with dim GFP, Dpy with bright GFP (mIn1 homozygotes), and non-GFP gk388 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT2906 mir-83(n4638) IV; mir-259(n4106) V; mir-34(gk437) X. C. elegans DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3032 mir-83(n4638) IV; mir-259(n4106) V. C. elegans DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3107 maIs388 II; mir-83(n4638) IV. C. elegans maIs388 [lim-7p::mir-83 + Cbr-unc-119(+)] II. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3108 maIs389 II; mir-83(n4638) IV. C. elegans maIs389 [dpy-7p::mir-83 + Cbr-unc-119(+)] II. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3109 maIs390 II; mir-83(n4638) IV. C. elegans maIs390 [myo-3p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3110 maIs391 II; mir-83(n4638) IV. C. elegans maIs391 [mir-83p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3111 maIs392 II; mir-83(n4638) IV. C. elegans maIs392 [lag-2p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3118 unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx246. C. elegans maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3145 unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx247. C. elegans maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3289 mir-83(n4638) IV; mir-34(gk437) X. C. elegans DTC migration defects. Generated from VT3106 and VT3110. VC3289 has the genotype as VT2595 but made from different parental strains. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3294 maIs387 I; maIs391 II; mir-83(n4638) IV; mir-34(gk437) X. C. elegans maIs387 [mir-34p::mir-34 + Cbr-unc-119(+)] I. maIs391 [mir-83p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.