Variation Information: ax2033
| Name | ax2033 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | II:0.38 +/- 0.022 cM |
| Genomic position | genomic coordinates unknown or not listed |
| Protein change | protein change unknown or not listed |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| JH3180 | nos-2(ax2033) II. | C. elegans | Maintain at 20C. ax2033 was produced by replacing +16 to +42 with TCGACTCTCGAACGATCGTAATAG in the first exon of nos-2. ax2033 mutants are sterile when fed nos-1 dsRNA. Reference: Paix A, et al. Genetics. 2014 Sep 23. |