Caenorhabditis Genetics Center (CGC)

Variation Information: mg366

Namemg366 View on WormBase
Species C. elegans
Genetic positionIV:-26.02 +/- 0.000 cM
Genomic positionIV: 418238..418238
Protein changeT07A9.5a T07A9.5b T07A9.5c T07A9.5d Insertion

Strains carrying this variation

Strain Genotype Species Description
GR1373 eri-1(mg366) IV. C. elegans Temperature sensitive: sterile at 25C. Maintain at 15C. Him. Eri. Due to a direct repeat the exact site and sequence of the 23 bp eri-1(mg366) insertion is unclear, however, the insertion lies in exon 6 of T07A9 between nucleotide positions 35215 and 35204 of cosmid T07A9 and includes 23 or these 32 nucleotides tttatcgaaaaaaaaacaggcactttatcgaa. Primers to follow eri-1mg366: GATAAAACTTCGGAACATATGGGGC and ACTGATGGGTAAGGAATCGAAGACG. These primers will give a 170 bp product in N2 and a 193 bp product in eri-1(mg366).
GR1379 lin-35(n745) I; eri-1(mg366) IV. C. elegans Temperature sensitive sterile at 25C. Maintain at 15C.
KP3948 eri-1(mg366) IV; lin-15B(n744) X. C. elegans Enhanced RNAi. Temperature sensitive sterile at 25C. Grow at 15 to 20C.
NL3630 pkIs32 III; eri-1(mg366) IV. C. elegans pkIs32[pie-1::GFP::H2B]. RNAi hypersensitive.
XE1057 eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. C. elegans Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1375 wpIs36 I; wpSi1 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. C. elegans wpIs36 [unc-47p::mCherry] I. wpSi1 [unc-47p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. GABAergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the GABAergic neurons; all other tissues are resistant to RNAi. Superficially wild type with mCherry fluorescence in the GABA motor neurons. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1474 wpSi6 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. C. elegans wpSi6 [dat-1p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Dopaminergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the dopaminergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1581 wpSi10 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. C. elegans wpSi10 [unc-17p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Cholinergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the cholinergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1582 wpSi11 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. C. elegans wpSi11 [eat-4p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Glutamatergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the glutamatergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.