Variation Information: tm410

Nametm410 View on WormBase
Species C. elegans
Genetic positionX:1.73 +/- 0.000 cM
Genomic positionX: 9946570..9946998
Protein change Deletion

Strains carrying this variation

Strain Genotype Species Description
EG3283 nas-37(tm410) X. C. elegans At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Deletion. Flanking sequences: ttcttgtccagtagggtctagtcgtggttg tgaacttgcctgtcgatgtcttctggctga.