Variation Information: ra204

Namera204 View on WormBase
Species C. elegans
Genetic positionX:-0.66 +/- 0.000 cM
Genomic positionX: 8051324..8051324
Protein changeC18A11.7a C18A11.7b Substitution

Strains carrying this variation

Strain Genotype Species Description
DM1245 unc-112(r367) V; Y102F5A.1(ra238) dim-1(ra204) X. C. elegans Y102F5A.1. Deletion extents determined by oligo array CGH. Deletion size: ~14kb. Deletion left flank: GGCAATCCTGGCCGAAGCTTTGAAACGCCCGAGTAAAGCCAAGAAGCGTC. Deletion right flank: GTTGTCTTTATCGAACCGCGTTGTTGAACTGTTGCATGAATCATGATTTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.