Variation Information: ok232
| Name | ok232 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | V:3.57 +/- 0.001 cM |
| Genomic position | genomic coordinates unknown or not listed |
| Protein change | protein change unknown or not listed |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| CZ3715 | gcy-33(ok232) V. | C. elegans | 1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele. |
| XA2262 | gcy-33(ok232) V; gcy-31(ok296) X; qaIs2241. | C. elegans | qaIs2241 [gcy-36p::egl-1 + gcy-35p::GFP]; causes genetic ablation of AQR, PQR, and URX neurons. Some residual neurons in the tail remain GFP+ from the gcy-35::GFP transgene. |