Variation Information: n1936

Namen1936 View on WormBase
Species C. elegans
Genetic positionX:12.72 +/- 0.125 cM
Genomic positiongenomic coordinates unknown or not listed
Protein changeprotein change unknown or not listed

Strains carrying this variation

Strain Genotype Species Description
CX2065 odr-1(n1936) X. C. elegans Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.]