CL6180 |
smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X. |
C. elegans |
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] |
CL691 |
dvIs19 III; skn-1(zu67) IV/nT1 [unc-?(n754) let-?] (IV;V). |
C. elegans |
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Segregates Unc skn-1(zu67) heterozygotes, arrested eggs/larvae (nT1 homozygotes), and wild type skn-1(zu67) homozygotes (sterile). All genotypes show constitutive weak GFP expression. Upon exposure to SKN-1 inducers (e.g., azide), strong induction of GFP is observered in skn-1/+ hets; there is no induction in skn-1 homozygotes. Pick Uncs to maintain -- although this strain is nominally balanced, nT1 can break down. Reference: Dostal, V., et al. Genetics. 2010 Nov;186(3):857-66. |
EU1 |
skn-1(zu67) IV/nT1 [unc-?(n754) let-?] (IV;V). |
C. elegans |
Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc. |
EU16 |
dpy-18(e364) pie-1(zu154) III; skn-1(zu67)/nT1 [unc-?(n754) let-?] IV; +/nT1 V; eDp6 (III;f). |
C. elegans |
Heterozygotes are Unc. Segregates Uncs (dpy-18 pie-1; skn-1/DnT1; eDp6), Dpy non-Uncs (dpy-18 pie-1; skn-1 with no Dp) which give only dead embryos, and DpyUncs (dpy-18 pie-1; skn-1/DnT1 with no Dp) which give only dead eggs, WT looking (dpy-18 pie-1; skn-1; eDp6) which give only dead embryos, and dead eggs. |
EU84 |
unc-5(e53) skn-1(zu67) IV/nT1 [let-?(m435)] (IV;V). |
C. elegans |
Heterozygotes are WT and segregate WT, Uncs which give only dead eggs, and dead eggs. |
JJ185 |
dpy-13(e184) skn-1(zu67) IV; mDp1 (IV;f). |
C. elegans |
Animals with the duplication are WT. Animals which have lost the duplication are Dpy and give only dead eggs. |