Variation Information: cg115
| Name | cg115 View on WormBase |
|---|---|
| Species | C. elegans |
| Genetic position | III:-1.43 +/- 0.000 cM |
| Genomic position | III: 5927948..5930253 |
| Protein change | Deletion |
Strains carrying this variation
| Strain | Genotype | Species | Description |
|---|---|---|---|
| CH1315 | zmp-1(cg115) III. | C. elegans | Superficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant. |