| AV280 |
unc-119(e2498) III; him-17(ok424) V; meIs5. |
C. elegans |
meIs5 [him-17::GFP + unc-119(+)]. him-17::GFP is expressed in the germline. meIs5 not mapped. |
| CB4845 |
unc-119(e2498) III. |
C. elegans |
Small, severely uncoordinated. Spontaneous segregant from N2/RW7000 (Bristol/Bergerac) hybrid strain. Daf-d. |
| JA1334 |
unc-119(e2498) III; weIs11. |
C. elegans |
weIs11[unc-119(+) + TAC-1::GFP]. |
| JA1354 |
unc-119(e2498) III; weIs12. |
C. elegans |
weIs12[unc-119(+) + pie-1p::GFP::csnk-1]. |
| JA1403 |
unc-119(e2498) III; weIs15. |
C. elegans |
weIs15 [pie-1p::GFP::eea-1(FYVEx2) + unc-119(+)]. Phenotypically wild type. Early endosomes in germline and embryos are GFP+. GFP is fused to the tandem FYVE domains of eea-1/T10G3.5, under control of the pie-1 promoter. Grows at any temp, but has bright GFP at 25C. |
| JJ1136 |
unc-119(e2498) III; zuEx24. |
C. elegans |
zuEx24 [hmp-1::GFP + unc-119(+)]. Animals with the duplication are WT. Occasionally pick green hermaphrodites to maintain. zuEx24 transmits at a very high frequency. |
| JR667 |
unc-119(e2498::Tc1) III; wIs51 V. |
C. elegans |
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Superficially wild-type. |
| KS411 |
lin-17(n671) I; unc-119(e2498) III; him-5(e1490) V; mhIs9. |
C. elegans |
mhIs9 [lin-17::GFP]. Full length lin-17, expressed T.p cells. Rescues lin-17 mutants. unc-119(e2498) may no longer be in the background. |
| MAH132 |
rrf-1(pk1417) I; unc-119(e2498::Tc1) III; wIs51 V. |
C. elegans |
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428. |
| PS4997 |
unc-119(e2498) III; syIs179. |
C. elegans |
syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |