| HL2000 |
+/szT1 [lon-2(e678)] I; nhr-25(jm2389)/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, dead eggs, and Lon males. nhr-25 is homozygous embryonic lethal. |
| HR1184 |
+/szT1 [lon-2(e678)] I; nmy-1(sb115) dpy-8(e130)/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Dpy Uncish with occasional Rol (nmy-1 dpy-8), Lon males, and dead eggs. nmy-1 homozygotes have a low brood size and are slow growing. sb115 is a null, truncation allele. |
| HR890 |
+/szT1 [lon-2(e678)] I; syDf1/szT1 X. |
C. elegans |
Heterozygotes are Lon and segregate Lon and dead eggs. |
| JK323 |
qDf3/szT1 [lon-2(e678)] I; +/szT1 X. |
C. elegans |
Heterozygotes are WT and grow slowly. Segregates Lon males. Do not grow at 25C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| JM69 |
dpy-5(e61) unc-13(e1091)/szT1 [lon-2(e678)] I; elt-2(ca15)/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Lon males and dead eggs. |
| KM48 |
+/szT1 [lon-2(e678)] I; cdk-4(gv3)/szT1 X. |
C. elegans |
745 bp deletion of cdk-4 from intron I to exon3 removing putative ATP binding domain and catalytic residues. Most homozygous animals arrest at L2 due to absence of most or all postembryonic somatic cell divisions. Some germline proliferation resulting in slightly elongated gonad. |
| KR1115 |
dpy-5(e61) unc-13(e450) hDf9/szT1 [lon-2(e678)] I; +/szT1 X. |
C. elegans |
Wild-type phenotype, Him. Segregates wild-type, Lon-2 males and two classes of arrested embryos (dpy-5 unc-13 hDf9 homozygotes and szT1 aneuploids). Lon males are fertile, carrying hDf9 and both szT1 half translocations (arising by meiotic nondisjunction of normal X chromosome). Maintain by picking wild-type and checking for correct segregation of progeny. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. |
| KR1142 |
hDf8/szT1 [lon-2(e678)] I; +/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Lon males and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. |
| KR1537 |
dpy-5(e61) let-540(h884) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. |
C. elegans |
Heterozygote is wild-type, segregating WT, late-larval arresting DpyUncs, szT1 homozygotes (lethal, probably embryonic), and aneuploids (dead eggs). Pick WT and check for correct segregation of progeny to maintain stock. Note that some lethals recovered by hT1 are expected to be outside the szT1 crossover suppression boundary and these strains may thus produce DpyUnc progeny. unc-29 marker may also cross away from szT1(I). |
| KR1588 |
dpy-5(e61) let-539(h938) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, arrested DpyUncs, Lon males and large number of aneuploid progeny (arrested embyros or larvae). Note that unc-29 is outside the recombination-suppressed region of szT1 and may cross off resulting in Unc-29 progeny. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. |
| KR1594 |
dpy-5(e61) let-542(h986) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, arrested DpyUncs, Lon males and large number of aneuploid progeny (arrested embyros or larvae). Note that unc-29 is outside the recombination-suppressed region of szT1 and may cross off resulting in Unc-29 progeny. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. |
| KR1598 |
dpy-5(e61) unc-13(e450) let-538(h990)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. |
C. elegans |
Wild-type phenotype. Segregates WT, sterile adult DpyUncs, Lon-2 males (szT1 hemizygotes) and a large number of arrested aneuploid progeny (mostly dead eggs). Pick WT and check for correct segregation of progeny to maintain. Note that unc-29 on szT1(I) lies in the non-balanced region and may recombine onto the normal LG I. |
| KR1692 |
dpy-5(e61) unc-13(e450) let-535(h993)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. |
C. elegans |
Wild-type phenotype. Segregates WT, mid-larval arrested DpyUncs, Lon-2 males (szT1 hemizygotes) and a large number of arrested aneuploid progeny (mostly dead eggs). Pick WT and check for correct segregation of progeny to maintain. Note that unc-29 on szT1(I) lies in the non-balanced region and may recombine onto the normal LG I. |
| KR1694 |
let-508(h995) dpy-5(e61) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. |
C. elegans |
|
| KR3910 |
dpy-5(e61)/szT1 [lon-2(e678)] I; +/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Dpys, Lon males and dead eggs. |
| KR926 |
hDf6 dpy-5(e61) unc-13(e450)/szT1 [lon-2(e678)] I; unc-3(e151)/szT1 X. |
C. elegans |
This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. |
| LW2286 |
lon-2(e678) X; jjIs2277. |
C. elegans |
jjIs2277 [pCXT51(5*RLR::pes-10p(deleted)::GFP) + LiuFD61(mec-7p::RFP)]; integrated on LG I or IV. Reference: Tian et al. (2010) Development 137(14):2375-84. |
| LX677 |
rgs-7(vs98)/unc-1(n496) lon-2(e678) X. |
C. elegans |
Heterozygotes are Unc but not Lon. n496 is dominant. Segregates LonUnc. vs98 homozygotes are non-Unc, non-Lon and are Mel (they give only dead eggs). Strain will break down due to recombination so check for the presence of vs98 by PCR every few generations. Received new stock Feb 2005. |
| ML855 |
+/szT1 [lon-2(e678)] I; ppk-3(mc46)/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, Lon males, mc46 hemizygotes (WT males) and mc46 homozygotes. mc46 is a deletion that results in homozygotes which show enlarged vacuoles (late endosomes and lysosomes) and lay eggs with enlarged vacuoles that die at different stages of embyronic development. |
| MT1401 |
+/szT1 [lon-2(e678)] I; nDf19/szT1 X. |
C. elegans |
Hets are WT and throw WT, dead eggs and Lon males. Maintain by picking WT. |
| MT1442 |
mcm-4(e1466) dpy-5(e61)/szT1 [lon-2(e678)] I; +/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Dpy (these are thin, sterile and Unc after L1--there is no sexual maturation), and Lon males. Maintain by picking WT. |
| MT1460 |
egl-17(e1313) lon-2(e678) unc-18(e81) X. |
C. elegans |
Egl. Lon. Unc. |
| MT1565 |
egl-17(e1313) lon-2(e678) X. |
C. elegans |
Long. Egl. |
| MT1671 |
unc-1(n496) lon-2(e678) X. |
C. elegans |
Dominant Coiler Unc. Lon. |
| MT1677 |
unc-1(n494) lon-2(e678) X. |
C. elegans |
Semi-dominant Coiler Unc. Lon. |
| MT1679 |
unc-105(n490) II; lon-2(e678) let-2(n821) X. |
C. elegans |
Long. n821 pka sup-20(n821). |
| MT1790 |
unc-78(e1217) lin-18(e620) lon-2(e678) X. |
C. elegans |
Some hermaphrodites (<50%) have single small protrusion posterior to vulva, occassional vulval rupture; temperature sensitive. Unc. Lon. |
| MT2867 |
unc-36(e251) III; unc-5(e53) IV; dpy-11(e224) V; lon-2(e678) lin-15B&lin-15A(n765) X. |
C. elegans |
|
| MT3324 |
lon-2(e678) egl-15(n484) X. |
C. elegans |
|
| MT3460 |
+/szT1 I; dpy-6(e14) egl-15(n1454)/szT1 [lon-2(e678)] X. |
C. elegans |
WT strain which segregates WT, Dpy L1 lethals, Lon males and dead eggs. Class II egl-15 mutation. |
| MT455 |
lon-2(e678) unc-18(e81) X. |
C. elegans |
Unc. Long. |
| MT458 |
unc-20(e112) lon-2(e678) X. |
C. elegans |
Lon. Unc-ts. |
| MT464 |
unc-5(e53) IV; dpy-11(e224) V; lon-2(e678) X. |
C. elegans |
Mapping strain. DpyUnc. |
| MT5439 |
sqt-3(sc8) unc-76(e911) V; lon-2(e678) xol-1(y70) X. |
C. elegans |
Roller. Long. Unc. XO Lethal. sc8 previously called rol-4(sc8). |
| NG2267 |
fax-1(gm27) lon-2(e678) X. |
C. elegans |
Unc and Lon. ME2-3. |
| NH2693 |
+/szT1 [lon-2(e678)] I; egl-15(n1456)/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Lon Males, early L1 larval arrested animals (n1456 homozygotes) and dead eggs. n1456 is an early nonsense mutation in the extracellular domain of EGL-15/FGFR (Q268 STOP). |
| OH160 |
otIs76 mgIs18 IV; lon-2(e678) hst-6(ot17) X. |
C. elegans |
otIs76 [pttx-3p::kal-1 + unc-122p::GFP] IV. mgIs18 [ttx-3p::GFP] IV. Long, otherwise phenotypically WT. ttx-3p::GFP labels AIY interneurons. hst-6(ot17) suppresses the branching phenotype of KAL-1 overexpression in AIY. hst-6(ot17) is closely linked to lon-2. |
| PS1032 |
syDf1/unc-2(e55) lon-2(e678) X. |
C. elegans |
Heterozygotes are Lon non-Unc. Df/Df is embryonic lethal. Maintain by picking single Lon non-Unc and check for dead embryos-->Lon non-Unc recombinants that have lost the Df arise frequently. Does not survive long periods of starvation-->survivors tend to be Lon non-Uncs without the Df. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| QP122 |
dpy-3(e27) lon-2(e678) unc-3(e151) X. |
C. elegans |
Dpy. Unc. dpy-3 is epistatic to lon-2. |
| RE249 |
qDf4/szT1 I; +/szT1 [lon-2(e678)] X. |
C. elegans |
Heterozygotes are WT. Segregates Lon males. Do not grow at 25C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| RG3078 |
+/szT1 [lon-2(e678) umnIs61] I; bcat-1(ve578[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. |
C. elegans |
umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Homozygous Let. Deletion of 2704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve578 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttaacacccgtatcattatcatttccatgc ; Right flanking sequence: cccaacttccttccaccccctcaaaaagcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3151 |
+/szT1 [lon-2(e678) umnIs61] I; T20B5.2(ve651[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. |
C. elegans |
umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Homozygotes are unhealthy. Deletion of 5228 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sickly adults (ve651 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaggggagggaaaacagttgaggacttttg ; Right flanking sequence: GAATGCGCATACTTGATGGAAAACCCGCTC. sgRNA #1: aacagttgaggacttttggt; sgRNA #2: ATCAAGTATGCGCATTCGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3202 |
+/szT1[lon-2(e678) umnIs61] I; ZK899.2(ve702[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/szT1 X. |
C. elegans |
umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Larval lethal. Deletion of 2110 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 early larval lethal (ve702 homozygotes), Lon non-GFP mKate2+ males (szT1 hemizygotes), and dead eggs (szT1 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tttaaaaaacgtagcacgcgtattttttac ; Right flanking sequence: tggaaaataattatatttcaactttgaaca. sgRNA #1: cttcaacttctctgacacag; sgRNA #2: tttcacaatttactagtaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| SD1135 |
+/szT1 [lon-2(e678)] I; dlg-1(ok318)/szT1 X. |
C. elegans |
|
| SP413 |
unc-7(e139) lon-2(e678) X. |
C. elegans |
Lon and Unc. |
| SP875 |
lon-2(e678) dpy-3(e27) X. |
C. elegans |
|
| SV411 |
heDf1 maIs103/lon-2(e678) unc-9(e101) X. |
C. elegans |
maIs103[rnr::GFP unc-36(+)] X. The heDf1 deletion includes cdk-4. Heterozygotes produce 1/4 thin, sterile, uncoordinated animals that fail to undergo postembryonic somatic cell divisions. heDf1 mutants are of L1 size, smaller than cdk-4 mutants. lon-2 and unc-9 do not exactly balance heDf1, but unc-9 is pretty close. It should also be possible to follow the heterozygotes by looking at the GFP. Despite trying, unable to separate the maIs integration from heDf1 or the other cdk-4 alleles. By maintaining animals with GFP (visible especially in early animals and in eggs) you should be able to maintain heDf1. rnr::GFP is expressed during S-phase in heterozygous animals. rnr::GFP expression is not detected in heDf1 animals. maIs103 is tightly linked to heDf1. Maintain by picking several single animals and scoring for 1/4 mutant progeny. |
| TP69 |
pdi-2(tm689)/lon-2(e678) X. |
C. elegans |
Heterozygotes are WT and segregate WT , Longs, and strong Dpys which are Sterile. Maintain at 15 degrees. |
| TP91 |
pdi-2(gk375)/lon-2(e678) X. |
C. elegans |
Maintain at 15 degrees. Heterozygotes are WT and segregate WT , Longs, and strong Dpys which are Sterile. |
| TU900 |
+/szT1 [lon-2(e678)] I; uDf1/szT1 X. |
C. elegans |
Heterozygotes are WT and segregate WT, Lon males and dead eggs. Maintain by picking WT. [4/98: Lon males are sickly and Unc. uDf1 appears to still be present.] |