| VC2333 |
Y34D9A.1(ok2837) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y34D9A.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2837 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCCGCAAAATCTCTTGAAAA. External right primer: AAACGGCACGTGCTTTACTC. Internal left primer: GAAATTTTCCGATTTTCTGCC. Internal right primer: TCCGAGTTTTTAAATGGCAA. Internal WT amplicon: 1222 bp. Deletion size: 475 bp. Deletion left flank: AGCTGAAAAAAATGTTTTTTTCCGGGATTT. Deletion right flank: GATTAAATCAAAAAAATAAGGAAAATATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2355 |
apr-1(ok2970) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
K04G2.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2970 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGATTTGTGATGGCACAGT. External right primer: GCAGCACCAGAAGTTGATGA. Internal left primer: ATGGTAACGATTTTCCAGCG. Internal right primer: TGGTTCTTCAGCAGTTAATCCA. Internal WT amplicon: 1205 bp. Deletion size: 665 bp. Deletion left flank: TCATCAATTGACGTCTCAACAGCAGAACAC. Deletion right flank: GCTCAGACTGGTCTCCACAACAACAATTAC. Insertion Sequence: AGGACACCCAGCGATCATAACGGCATTGATGTGGCAAGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2372 |
F14B4.3(ok1970) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F14B4.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1970 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAAAACAGTTGGCCCAAAA. External right primer: CCATCTCCGTGGAATGTCTC. Internal left primer: ACAAATGGCGATGCATCATA. Internal right primer: GGTGAAGAGCCAATCGAAAA. Internal WT amplicon: 3259 bp. Deletion size: 1241 bp. Deletion left flank: GAAAACTTACCGTGGTGACTGATTATGATC. Deletion right flank: ATTTACGTAGATTTAGGTGCGTCTAAGGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2380 |
K10D2.4&cid-1(ok2756) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
K10D2.4, K10D2.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2756 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 547 bp. Deletion left flank: TCACTTGCAAGACAGTGTGGCTATTCTGAC. Deletion right flank: AGAAACGCCACTTTTATTTATTTATCAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2381 |
T16H12.1(ok2764) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
T16H12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2764 homozygotes (late larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTCGCTCGATTTGTTCGTT. External right primer: TCGAGGAGCCTTTTCACATT. Internal left primer: GACGCAAATTCGAGAAGATTT. Internal right primer: TGACACTGTCGAATAAGGCG. Internal WT amplicon: 1149 bp. Deletion size: 613 bp. Deletion left flank: TCGTTCGACGCAAATTCGAGAAGATTTTGT. Deletion right flank: TTCGAAACTTTATCGAGAGAAACATTGAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2405 |
chc-1(ok2369) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
T20G5.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2369 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAAGACTCCGTCAATTCGT. External right primer: CGATTGGCTGCGATACTTTT. Internal left primer: CGTTTACAGCAACCACCTGA. Internal right primer: GTCTTTTGCGGAAATTCCAA. Internal WT amplicon: 3239 bp. Deletion size: 1382 bp. Deletion left flank: AAATAAAATGTGCGATTTCGCAATACCCAT. Deletion right flank: TGTTGTTCGTGAGATGGTAGGTCAAATAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2410 |
sma-4(ok3140) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
R12B2.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3140 homozygotes (late larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACGGAAAGGTGTTCCACAT. External right primer: GGTCCGTGCAGAAAATCAGT. Internal left primer: CGCAAGAATATGGAGATGGC. Internal right primer: TGCTCGTACTGCTTCATTGC. Internal WT amplicon: 1288 bp. Deletion size: 718 bp. Deletion left flank: AGAGGTGGCTGCTCTCTCTCTCTGACTTTT. Deletion right flank: TTCGTCCGATCCGGGTACCTAGACTACACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2411 |
Y48G1A.4(ok3096) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y48G1A.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3096 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAAACTCGCAAAAATTCGCA. External right primer: TCAAATTGCACAAATTCCGA. Internal left primer: TGAAGTGTTTGCGTACAGCG. Internal right primer: TTTTTGGGTTTTAGGTTTTCCA. Internal WT amplicon: 1221 bp. Deletion size: 520 bp. Deletion left flank: TGCGCACGACTTGACGCGCAAACTTCCCAA. Deletion right flank: GGAAAAGCGCTCTCGGACATTGAAAAATAC. Insertion Sequence: CAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2481 |
rbg-2(ok3195) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
T22C1.10. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3195 homozygotes (Dpy sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTTGCCAAGCAGGTTAAAA. External right primer: CGACACATTTTGTGCCACTC. Internal left primer: TATTTGCTCGGAGATTTCGC. Internal right primer: ATTCGAGCAGGTTCCGTAGA. Internal WT amplicon: 1279 bp. Deletion size: 809 bp. Deletion left flank: TTTTCAGCAAAGTTCGAACGAAAAAACTCT. Deletion right flank: TTGATAGCAAAATGCGAAAAAACAGTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2495 |
sur-6(ok3215) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F26E4.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3215 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCAGCCGATGTGATCTCTTG. External right primer: TGTTCAAATCCCACACCTGA. Internal left primer: GAATATTTGGCAACGGGAGA. Internal right primer: CCTTGACAGTAAGATAGTCCCTCG. Internal WT amplicon: 1263 bp. Deletion size: 438 bp. Deletion left flank: AATCAAGTATAACATTAATGATTAAATATT. Deletion right flank: GTTAACCTTTGGAATCTGGAGATTACCAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2511 |
Y52B11A.2(ok3233) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y52B11A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3233 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGAGCCTCACTCAAAACT. External right primer: AGTGGTCCATATCTCCGTCG. Internal left primer: GAAAATGTTCACGAAACGCA. Internal right primer: GGAGCAGAAAGAGGTGCTTC. Internal WT amplicon: 1301 bp. Deletion size: 675 bp. Deletion left flank: ACTAATAGAAAATTCAAAAATTGGGTGAGA. Deletion right flank: AAGATCCTAAAACTATTTTAAACTTCTTTT. Insertion Sequence: TAGATCCTAAAACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2512 |
ugt-60(ok3248) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C07A9.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3248 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGGTTTCGGACTTGTTGC. External right primer: CGCATCCACTTTCTTCAGGT. Internal left primer: CTGAGAGCATCGCGGATAGT. Internal right primer: TGACGCGTCTAGCTCAATTTT. Internal WT amplicon: 1354 bp. Deletion size: 525 bp. Deletion left flank: TATAGCCTCCATGTGCAATCATTAATTTCA. Deletion right flank: AACCTCGATAGAACAAATTCTCGTCAACGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2550 |
inx-14(ok3267) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F07A5.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3267 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAAAACCAACCGGTTCAAG. External right primer: ATCACCAAACCGTTCAAAGC. Internal left primer: CTTGAAAAGAGCACCGATGA. Internal right primer: GGTGCTAAACAACATTTCGGA. Internal WT amplicon: 1264 bp. Deletion size: 544 bp. Deletion left flank: ATTAAAAGAATTCCGTCGGCACACAGGTAC. Deletion right flank: CACGAATCAACGTCCAAGAATTTGCAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2563 |
Y75B8A.24(ok3320) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y75B8A.24. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3320 homozygotes (grotty sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTTCCCCTACCTAACAGCC. External right primer: GAGAAGGAAGTTGTCGGTGG. Internal left primer: ACAGAAGCTCATCTGCCGAG. Internal right primer: ACGTCGCATCCTACTCGTCT. Internal WT amplicon: 1206 bp. Deletion size: 389 bp. Deletion left flank: CTCATCTGCCGAGTAACTTCTCAGCACTCT. Deletion right flank: CCAACGCTAGCGGATGGAGCCAAGCACTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2566 |
F23C8.6(ok3325) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F23C8.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3325 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCGGGGTCAAAGTACACACT. External right primer: CCGCAGATACACACACATGA. Internal left primer: CCGAAATTCGAAATTTTAGCC. Internal right primer: TTTTTATCGCTTTCTTGCGAA. Internal WT amplicon: 1309 bp. Deletion size: 702 bp. Deletion left flank: GTCGGCAGAGCAGTTGGCACGTTTGACGGA. Deletion right flank: GTGCTTTTATAAGTTAAATTTCGCAAGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2620 |
dpy-14(ok3341) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
H27M09.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3341 homozygotes (grotty, lumpy sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTAGGTGAACCCACGAGCAT. External right primer: TGGATCAATCGTCTCCTGCT. Internal left primer: ACAGTCACGGGAAAACAGGA. Internal right primer: TGAACTTTGATATGCAACACAGAA. Internal WT amplicon: 1195 bp. Deletion size: 691 bp. Deletion left flank: TCAGCCACGCTCGTCGTATTGCCATCGCAG. Deletion right flank: ACCACCAGGAAAGAAGGGAGATGATGGAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2632 |
nekl-2(ok3240) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
ZC581.1. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3240 homozygotes (slow-moving Unc, may be sometimes sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACGTGGTGCTTTTGGAGTT. External right primer: TCCGCTGTTTGACCTACAGA. Internal left primer: CTGTGTCGCGGTAAAAATGA. Internal right primer: GCATGACGTCGATGGTTTC. Internal WT amplicon: 1365 bp. Deletion size: 602 bp. Deletion left flank: CTTTTTACTGAAACAAATATTTTTGAAGAT. Deletion right flank: CTTTCCGATCCACTTGTTCTTCCCTATTTG. Insertion Sequence: GTAATCGATTAATTTTCAGAGCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2641 |
oct-1(ok3339) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F52F12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3339 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CATATGCCTCGTCCTGGAAC. External right primer: GGCCATGTTCATCAGAAGGT. Internal left primer: TTTCTTTACCACGAAGTAAGCG. Internal right primer: TCTGAATGTTTGAAAGTCGCA. Internal WT amplicon: 1354 bp. Deletion size: 696 bp. Deletion left flank: CATTGAAGTAGAGGCCAAACAACGAAATAT. Deletion right flank: TCTGAATTAAAAATGCTTAATTCAGAAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2648 |
sec-8(ok2187) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y106G6H.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2187 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAGCCTTTTGAGAAACACG. External right primer: CATAAGAAAGCTTCGCAGGC. Internal left primer: CCCTGCCACTGTGACAATTA. Internal right primer: GGAGCCAAATGGAAGAAACA. Internal WT amplicon: 3170 bp. Deletion size: 1128 bp. Deletion left flank: ATACTGCCTGTGCGACTCCAAATGCCAACT. Deletion right flank: AGTTTTTCAGAAATTAAAAAACCTTTATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2660 |
tax-2(ok3356) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
ok3356. Homozygous constitutive dauer deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3356 homozygotes (constitutive dauer, probably non-recovering). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGCCAAGAAGTGAAGATTCC. External right primer: ACGCTTGTAATGCCGAAAGT. Internal left primer: GCAAATGCTTCAAAAGAGCC. Internal right primer: GAGTCCGAGCAATTCTGAAAA. Internal WT amplicon: 1122 bp. Deletion size: 367 bp. Deletion left flank: AGGAACATTTCATCCGTATGGTCGTTTCTA. Deletion right flank: TTTGGAGGATTAATCGAGTTTTGAAGGTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2666 |
ceh-6(ok3388) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
K02B12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3388 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCTTTCTTCCAGCTTGCC. External right primer: TAGGGCCAGAAAATTGAACG. Internal left primer: AAATGTAGAATTGGGCGAGC. Internal right primer: GGTAGGCGCACATACCATTT. Internal WT amplicon: 1129 bp. Deletion size: 405 bp. Deletion left flank: TCTGAATAATTTCAGGTCGTTCAACTTCCT. Deletion right flank: AAAATGGTATGTGCGCCTACCAATTGAAAA. Insertion Sequence: AAAAGGATTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2705 |
zwl-1(ok2378) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y39G10AR.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2378 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCGCGAAAACAAAACAATTT. External right primer: TGAGGAAATTTCGGCTCATT. Internal left primer: TTTCCCAGAAAATGCCACTC. Internal right primer: GCAACTCTGGCATGCTTTTT. Internal WT amplicon: 2881 bp. Deletion size: 2093 bp. Deletion left flank: CAGCGGTTGTGACAAAGAAAAGTGTGCGAA. Deletion right flank: TTGCAACGGAGAATCGACCGGCTCCTGGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2706 |
wve-1(ok3308) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
R06C1.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3308 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAAAGCTGGGACTTCGTTG. External right primer: TTTTGGCTGCTCGCTTTTAT. Internal left primer: GGGTTTCTAGCGATTTTTCCA. Internal right primer: ACGATTTTCGTGCCAATTTC. Internal WT amplicon: 1322 bp. Deletion size: 556 bp. Deletion left flank: TTGGCCTGCTCGGGGAGCACAAGAGCTGTG. Deletion right flank: CTGTAGGTAAAGTGCTTCTATCCAGAATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2709 |
Y110A7A.8(gk1094) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y110A7A.8. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1094 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. (Note: in this strain hT2[qIs48] occasionally recombines such that the GFP and its associated lethality are lost and the non-GFP hT2 left behind still carries the bli-4 mutation of the original hT2. Such a recombination event results in a viable non-GFP animal that is no longer gk1094/hT2[qIs48] but is gk1094/hT2.) External left primer: TTTCATTCTCTTCGCGACCT. External right primer: CACACTCCAGCACTGGAAAA. Internal left primer: TGCAGCAATGAAGAGAAACG. Internal right primer: TTTCGCATATGGGTCGAAAT. Internal WT amplicon: 2229 bp. Deletion size: 1953 bp. Deletion left flank: AGCGAACTGCAGCAATGAAGAGAAACGAGA. Deletion right flank: ATATATTTATTTGTTACTTTCCTCTTCCTG. Insertion Sequence: GAACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2726 |
pfd-6(ok3600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F21C3.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3600 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAATTTGTGGTTGGGGATT. External right primer: ATTTCAACGCTGCTGGAGAC. Internal left primer: ATGATGGCTGACTTTGAGCA. Internal right primer: TGCAAAGTTGGTTTTCACGA. Internal WT amplicon: 1193 bp. Deletion size: 445 bp. Deletion left flank: ATTTTAAAACGTTTAAAGGTAAAATTTATT. Deletion right flank: AAAAGAAGTGAAAGAAAACAAAATTGTGTT. Insertion Sequence: AT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2731 |
ahcy-1(ok3601) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
K02F2.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3601 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACGAGGAATACGAATGGTGC. External right primer: CGAAATGAGTGAAGCGTTGA. Internal left primer: CAAGGATGGACAACCACTCA. Internal right primer: CGGGTAGATGGGGAACAATA. Internal WT amplicon: 1126 bp. Deletion size: 715 bp. Deletion left flank: AAAGGGATCTGCTGCTTCCCTCAAGGCTTT. Deletion right flank: AAATTGTATTGCCCTCAAACTTCATATGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2733 |
C08C3.4(ok3550) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C08C3.4. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3550 homozygotes (phenotype uncharacterized). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTACTTTTATGCCGGCCAAC. External right primer: AGCACTAGAAATGCGCCAGT. Internal left primer: TGTCGACGAGAACTGACATTG. Internal right primer: CTTTTCTTCAATTTCCGCGA. Internal WT amplicon: 1184 bp. Deletion size: 589 bp. Deletion left flank: GCTGTTTGGGTCACATTGAGACATGGCGCA. Deletion right flank: AGTGGTTTCCTCATTGGGCAGAAGGTGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2789 |
C18E3.2(ok3161) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C18E3.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3161 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAGGAAGTGCTCCACAAAT. External right primer: AACTCGTGTCGCTTCTGGTT. Internal left primer: CCATTGCCGAAAAAGAAGAA. Internal right primer: CACCTTTTGGAACATGTATCTG. Internal WT amplicon: 1250 bp. Deletion size: 1122 bp. Deletion left flank: AAAGAAGAAGTATGCGGATAAATGTATTCA. Deletion right flank: GAGGAAGGAGTTCAAAGGTATTTGCCGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2824 |
H28O16.1(ok2203) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
H28O16.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2203 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAATCCTGACAGCTCGTTGG. External right primer: TTCGAAACAGGAGCTTTGCT. Internal left primer: TGTTGTCCAAACGCATTGTT. Internal right primer: ATTCTCGCAGAACACACACG. Internal WT amplicon: 2289 bp. Deletion size: 1121 bp. Deletion left flank: GACGTGTTGTTGACGCCCTCGGAAACCCAA. Deletion right flank: ATACCTCGACAAGGTCGACCCATCCGCCAT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2825 |
rpl-30(ok3566) I/hT2g[bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y106G6H.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3566 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. xternal left primer: CCAAAAACCGGAAAAAGACA. External right primer: AAAAACGTCCGATGCAATTC. Internal left primer: AGTGTTTCAAGGGAGGAGGG. Internal right primer: TCCATCCGTGACATCGTTTA. Internal WT amplicon: 1153 bp. Deletion size: 474 bp. Deletion left flank: ATTAGAAGTTCACGCAGTTATTTTTTCTAT. Deletion right flank: CTACAACGGAAACAACATTGAGCTCGGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2828 |
Y79H2A.3(gk1219) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y79H2A.3. Maternal-effect lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1219 homozygotes (Mel; F2 homozygotes arrest as early larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAACATGCTTCTTCCATGCC. External right primer: AGCGAAATTTGGACTAGCGA. Internal left primer: TTCATTGCGTGATATTCCGA. Internal right primer: TCTGGACGTGTGCTACTTGC. Internal WT amplicon: 1396 bp. Deletion size: 1073 bp. Deletion left flank: GTTCATCACCAGCATTAATGAGATATCGAT. Deletion right flank: TAGCTAATTTTGAACCGCCATAAAACTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2960 |
C50F2.3(ok3662) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C50F2.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3662 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATGGCCGACAAAGAAAATG. External right primer: TTTTTCCAACTTTTCCGTGC. Internal left primer: ATGCCGAACTCTGAGACGAT. Internal right primer: AAAAGTTGGCGAAATTGGTG. Internal WT amplicon: 1186 bp. Deletion size: 656 bp. Deletion left flank: TGGAGAGCACTCTGTGACACTTATGAGAGA. Deletion right flank: CGAGAAGTGTCGATTATGATGCAAGAAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC2999 |
R151.2(gk3067) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
R151.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3067 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACAAAGATCACTCAATCCATCA. External right primer: AACATCGTCGTTCAGAATCTCAT. Internal left primer: TTTCTCTTGGGACCTTTGGTAA. Internal right primer: AAAATGAGCAGAATCGAATGGT. Internal WT amplicon: 1962 bp. Deletion size: 1090 bp. Deletion left flank: AGTTTTGGCAACTTATCAGTTAGAATAAAA. Deletion right flank: CCTCAAAATTTCAGATTGGTTGAAGCCGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3150 |
ekl-1(ok1197) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F22D6.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1197 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCGTACACATTCATCGTTGC. External right primer: CGGTATGTGTGGATGTCGAG. Internal left primer: GCAATGCTCTTCTCTGTCCC. Internal right primer: GAGATCAATTTGGCCATTCG. Internal WT amplicon: 2672 bp. Deletion size: 1008 bp. Deletion left flank: ATTTTTTAAAGAACTGGAAGAAATGCGAAT. Deletion right flank: TGTGAGTGAATATAACCAAAACACCAATGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3194 |
sca-1(ok3768) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
K11D9.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3768 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGAACCACCACATTGAGGC. External right primer: GGAGAAGCCACTGAAACTGC. Internal left primer: GAGTCCATCGTTGGCTGAAC. Internal right primer: TGAGAAGATGAATGTTTTCGGA. Internal WT amplicon: 1129 bp. Deletion size: 763 bp. Deletion left flank: GAGAGCAGTGGCTGGAAGACCGTCAGTGAC. Deletion right flank: TGAGTCATGGCAGAGGTGAGTGGAACCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3196 |
smgl-1(ok2423) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F20G4.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2423 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAACCAATCCAGCTTTTC. External right primer: CCAAAACGAGAAGACGGAGA. Internal left primer: TTCGACTTTTTCGGCGAT. Internal right primer: ATGGAACATCCTGATGCTGA. Internal WT amplicon: 1173 bp. Deletion size: 637 bp. Deletion left flank: TTCTAAAAATAATTAAATTAGAGTGTTAAA. Deletion right flank: CGTATGGTTGCCACGTCGCGAGATCATGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3199 |
tbx-33(gk3098) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y66A7A.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3098 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATATTGAAAACTAGGAACTTGGCG. External right primer: CCTACCAGAATCAGTATGCACATC. Internal left primer: CTGAATTTGTTCCATTGTTAGAAAGA. Internal right primer: CTTAAAGTCAAAAACAAACGTTCAAA. Internal WT amplicon: 1543 bp. Deletion size: 474 bp. Deletion left flank: AGGATTAGGCATAGGTTTAGGCTTAGGGTT. Deletion right flank: TTGTAGTTGGATTCTGGATTGAGATGCTCG. Insertion Sequence: GGGCTTAGGATAAAGCTTTGGCTCACGCTTAGGTTTAGGATTAGGTATAGGTTTAGGCT TAGGGTTAGGCTTAGGGTTAGGCTTAGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3267 |
ned-8(gk3086) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Homozygous sterile deletion chromosome (gk3086 in F45H11.2) balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3086 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGCGATGAGACCCATCTATT. External right primer: CGACAATGTGGTCGTTTTTG. Internal left primer: CTTGTGTCGATTTACGGGCT. Internal right primer: ATGGAAGAGTGCAAGTTCGG. Internal WT amplicon: 1685 bp. Deletion size: 1145 bp. Deletion left flank: ATTCTCAGGATTTTTTGTTACCATAGTGTT. Deletion right flank: TCTTACAAATACTGCGCGTTCTGATCTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3368 |
ubl-5(gk3358) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F46F11.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3358 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCCTCCGAAGAGAGCTTAT. External right primer: TCGCTGCCTAAACTTTTCGT. Internal left primer: ATTGCCCTTGGTCTGAAATG. Internal right primer: GTGCATGCGCCTTTAAGTTT. Internal WT amplicon: 1544 bp. Deletion size: 487 bp. Deletion left flank: GTTATTAATGTTTTTTCTCATGTAAAATAT. Deletion right flank: GTGATTTCAATCATTTTTCCTGAAAGGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3372 |
mrpl-47(ok1340) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
B0261-4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1340 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCAAGCTTTTGCACCTCCT. External right primer: TGTGGCTGCTTTGTTCTGTC. Internal left primer: CTGGAGTTTTGCGGACTTTC. Internal right primer: TCTGCCGATTTAGTGCATTG. Internal WT amplicon: 2114 bp. Deletion size: 620 bp. Deletion left flank: AAATTTAAATTTAAGGTATGTGTGCTTGAA. Deletion right flank: CCATTGTTCTTTTTTCTTGATATTTTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3434 |
pot-1(ok1292) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
B0280.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1292 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTTCCGGTCTTCGTCTAC. External right primer: ACTTTCAGCTCCAGACGCTC. Internal left primer: CGCAGCAACATCATTCAAAC. Internal right primer: ATAGATTGAGCGCCGAGAAG. Internal WT amplicon: 2359 bp. Deletion size: 916 bp. Deletion left flank: CTCATCAAGTTGATCAGTTTGCTGAGTTCA. Deletion right flank: CCTGAATATTTTTTTTGAATCTAGTAACTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3455 |
kin-18(ok395) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Homozygous sterile deletion chromosome (ok395 in T17E9.1) balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok395 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CATCAACCAGTTGCATCCAC. External right primer: TTACTGAGTTGTTGCCTGCG. Internal left primer: GACGCCATCCTCGATTTTTA. Internal right primer: CTCGATTCAGATCGGCTTTC. Internal WT amplicon: 3219 bp. Deletion size: 1767 bp. Deletion left flank: ATAATTTTCGATAGAAAAATGTATATTAAT. Deletion right flank: GAAGTAGTTCGACGACGAGCTCCGCACGCC. Insertion Sequence: AGAAAAATGTATATTAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3460 |
prp-8(gk3511) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C50C3.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3511 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACTGGGAAACTCCG. External right primer: ACTGAACATGGGCATCAACA. Internal left primer: AATTACGAAATCGCCGTTTG. Internal right primer: TCTCTGCACAAATGGAATGC. Internal WT amplicon: 2731 bp. Deletion size: 1823 bp. Deletion left flank: TTTTTTTTAAGTTGGACAGTTTTTAAAGTT. Deletion right flank: GCAACTTGAAAGCAGTGAGTTATTTACAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3462 |
alh-12(gk3392) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y69F12A.2. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP heterozygotes, arrested hT2 aneuploids, and possibly non-GFP gk3392 homozygotes (if not Emb; undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.External left primer: CGGATCTGTCTGGTGGACTT. External right primer: GTTTCCAGCCGATACGACAT. Internal left primer: GCAACAGCGGATATTGTTGAT. Internal right primer: CAATTTTCACGTCCATGTCCT. Internal WT amplicon: 1413 bp. Deletion size: 709 bp. Deletion left flank: TCCAGGTGGACCATCTCAACGTATTGCCTA. Deletion right flank: ATTACTGGACTTTCCGATGAAGCTAGAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3465 |
flp-22(gk1201) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F39H2.1. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1201 homozygotes (variable arrest, at least some animals persist to sterile adulthood). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACGGTTTCCTTTTGAGCAG. External right primer: ATCCACTTGGGTTTCGTTTG. Internal left primer: TTCCGGAAACCGCATATTAG. Internal right primer: TTACGCAATGCACACACTGA. Internal WT amplicon: 2028 bp. Deletion size: 471 bp. Deletion left flank: TCAGCAAAATGGATGAGATTTGGAAAGCGT. Deletion right flank: TTTTTGAAGATCAAAGCGAAATAAGACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3468 |
sca-1&K11D9.5(gk3383) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
K11D9.2, K11D9.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3383 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGATGTTCTTCCATGGTGGC. External right primer: TCATGAGCTTCGCATTTACG. Internal left primer: AAGAACCACCACATTGAGGC. Internal right primer: AAGCGCTCAAGGAATACGAA. Internal WT amplicon: 2327 bp. Deletion size: 861 bp. Deletion left flank: CTTCAGATTGTTGCTCTGGTGGAAGATCGT. Deletion right flank: GTCCAGCGATGAACATCTTTGACACAGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3472 |
C23G10.8(gk3389) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C23G10.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3389 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCATTGAATCTCCCGTGTCT. External right primer: ATACTCAGTCAACGGCCAGG. Internal left primer: TGCATTCGTTTATCCATCCA. Internal right primer: TGTTTGAACTGCTTTGCCTG. Internal WT amplicon: 1992 bp. Deletion size: 418 bp. Deletion left flank: TCAAGTTTCAGCGAATTAAAAAGCTTCTCA. Deletion right flank: GGCCATCCACTCCATGAACGTTTTATCGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3479 |
aph-2(gk3380)I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
aph-2. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2950 homozygotes (arrest stage not determined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGAAGTGGAGATAGGTGGG. External right primer: TGTTTCAGAACAGCGACCTG. Internal left primer: ATTCCGAGTGTCGTTTTTCG. Internal right primer: CCATTTAAAGGCGCAAACAT. Internal WT amplicon: 1456 bp. Deletion size: 426 bp. Left flanking sequence: AAAGAAACATTGAATGTGAAAAGTGAAAAG. Right flanking sequence: GAGTTTCGCATTAAAGAAAACTAGATTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3481 |
cdc-6(ok1368) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C43E11.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1368 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAGAACGTGTACCCGAAGGT. External right primer: TTCCCGATGCTTCACTTTCT. Internal left primer: AGAGAACGCGTTGAAAGGAA. Internal right primer: TTCACCCCTTTCGTGGATAG. Internal WT amplicon: 2704 bp. Deletion size: 1290 bp. Deletion left flank: TGATAGCCGATTTTGCCGTCGGAGCATCAA. Deletion right flank: TAATTTCTTCGCTGTCAGATTCCGATGAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
| VC3557 |
crml-1(gk3542) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
K07G5.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3542 homozygotes (sterile, lays some eggs but none hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTGCCTTTTGTAGATGTGATAGGA. External right primer: TAATCCGAAAGTCACAAAATCTGA. Internal left primer: GTCCCCACAGATGACGTTCT. Internal right primer: CCTTGCATCAGCTTTTCACA. Internal WT amplicon: 1884 bp. Deletion size: approximately 1125 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |