VC1684 |
C34B2.8(ok2168) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C34B2.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2168 homozygotes (mid-larval arrest, thin Unc sometimes with withered tail). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTTTCATTCCACCTTCGGA. External right primer: CATCTGCTCCAACGACTTCA. Internal left primer: AACAACCGCGTCAAAAGTGT. Internal right primer: ATTCGTCTCGATTTGCTGCT. Internal WT amplicon: 2130 bp. Deletion size: 1250 bp. Deletion left flank: GACCCACCGCTCAATTTTTGTTCCTGCGCC. Deletion right flank: TTGAATGCACGATAGCCTCCTTTTGGAGGC. Insertion Sequence: AAAAGTGCGATGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1685 |
cogc-1(ok2123) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y54E10A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2123 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAATTCGCCAAAAGGGTCT. External right primer: AGCAGAAGCTGGAGCACATT. Internal left primer: CTGACAATTTTTGGGCTCGT. Internal right primer: GCCATCGTTTCTTTGAGAGC. Internal WT amplicon: 3367 bp. Deletion size: approximately 1600 bp. Deletion extents narrowed to region between Y54E10A coordinates 80020 and 81877. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1706 |
C38H2.2(ok2175) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C38H2.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2175 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGTGCTGGTGATATGGCAA. External right primer: GAAAAGGCACAGGGTGTGAT. Internal left primer: TCAGACAACCTACGACGCTG. Internal right primer: AGGGTGGAGAACAGTCATGG. Internal WT amplicon: 2946 bp. Deletion size: 767 bp. Deletion left flank: GCGAAGAAGGTTCGCGTCTTCTGTTGGATT. Deletion right flank: GGTAATTTCAGATTCATTGAAGTAGCGCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1730 |
C36B1.8(ok2141) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C36B1.8. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2141 homozygotes (often sterile or nearly sterile, but a population can be maintained and will starve a plate). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAGGACGGCTGTTCCTAAA. External right primer: CATATTGAGCTGGAGTCGCA. Internal left primer: CGAGTACAGAACCGAGGAGG. Internal right primer: ACAATACGCTCTCCGTTTGG. Internal WT amplicon: 3357 bp. Deletion size: 1835 bp. Deletion left flank: TTCTAGCATCTAAATTTTAACAATTAGATT. Deletion right flank: AAATGTATTTTACAACACAATTTCCCTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1732 |
let-526(gk816) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C01G8.9. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk816 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. (Note: in this strain hT2[qIs48] occasionally recombines such that the GFP and its associated lethality are lost and the non-GFP hT2 left behind still carries the bli-4 mutation of the original hT2. Such a recombination event results in a viable non-GFP animal that is no longer gk816/hT2[qIs48] but is gk816/hT2.) External left primer: GCCATCACTTTCATCGGATT. External right primer: AATAGACGGCACGTGGAAAC. Internal left primer: ATTCGTTGTTGATAAGCCGC. Internal right primer: ATGACCGATGATGATGACGA. Internal WT amplicon: 1843 bp. Deletion size: 1268 bp. Deletion left flank: AGACATAGACGTCATGCGAAAAATAATATA. Deletion right flank: TCTATATATTCTCCGCGTGGTGGGCTATTT. Insertion Sequence: TATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1733 |
nekl-2(gk839) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
ZC581.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk839 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCGCCCTCTAAATTGTCA. External right primer: GCAGATTTCGTTCCAAGCTC. Internal left primer: TCTTTGTTAGCCATTTCCGC. Internal right primer: GAACAGTCTTTCGGCGATTC. Internal WT amplicon: 1654 bp. Deletion size: 506 bp. Deletion left flank: ATTTCTTGCCGTTTCGTTGAAATTGTTAAC. Deletion right flank: TGTGTTATAATCTACTAACTTTATAATTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1741 |
spe-11(ok2143) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F48C1.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2143 homozygotes (sterile, lays unfertilized oocytes). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTGGGTGCAAAACAGGTTC. External right primer: GGCTTACAGCTCTTGGTGGA. Internal left primer: GACCAAATTGAAGCGCATTT. Internal right primer: GAACATTTTTCCGTCAACCG. Internal WT amplicon: 2133 bp. Deletion size: 1196 bp. Deletion left flank: TCTCCAAACTCACTTATTGGAAAAAGCGTC. Deletion right flank: ATAAGTGAGATATCGGCCAAGCAATAGGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1752 |
Y23H5A.2&cars-1(ok2280) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y23H5A.2, Y23H5A.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2280 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCCATGGAAAAGATCCGAA. External right primer: TGGAACGGAGGTAAAACGAC. Internal left primer: ACCCCATATCGTGTCAATGG. Internal right primer: ACGGATTCAAGATCTGGTGG. Internal WT amplicon: 2132 bp. Deletion size: 475 bp. Deletion left flank: CAACGCGACCGCCGAAGCCGCACAATTCTG. Deletion right flank: TTCTCCGGATCTCGAAGAAAAACGCCGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1774 |
nekl-2(gk841) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
ZC581.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk841 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCGCCCTCTAAATTGTCA. External right primer: GCAGATTTCGTTCCAAGCTC. Internal left primer: TCTTTGTTAGCCATTTCCGC. Internal right primer: GAACAGTCTTTCGGCGATTC. Internal WT amplicon: 1654 bp. Deletion size: 354 bp. Deletion left flank: TTCAAATGGACAATTATGAAAAAGTGCGTG. Deletion right flank: TATTGATTCTTTTATTATGGATAATCAACT. Insertion Sequence: ATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1787 |
C17E4.6(ok2296) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C17E4.6. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2296 homozygotes (viable Unc, sickly, BMD, vulval defects). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACGACCTCTTGGACGAAAT. External right primer: CCAACCCCAACTGCCTACTA. Internal left primer: AGTGCGAGTGCGTTACACTG. Internal right primer: GGAGCCATAGTCGAGAGACG. Internal WT amplicon: 2597 bp. Deletion size: 1233 bp. Deletion left flank: GATGATATTCTAGCTAAGAACAAGAAATGG. Deletion right flank: TCAACGACGACAACTCTACCAGTCAACGTC. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1825 |
F44E2.8&F44E2.9(ok2134) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F44E2.8, F44E2.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2134 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGCTGGTTGGTTTCACCAT. External right primer: ATATGTGGAACTTGCCGGAG. Internal left primer: CATTGGAGAGAGCTTAGGCG. Internal right primer: TCGTTTTTAAATTTCCGCCA. Internal WT amplicon: 2111 bp. Deletion size: 1195 bp. Deletion left flank: TTTTTGTCGAACTTCATTCTTTACTTTACT. Deletion right flank: GGAAATAAAATCGATAAAAACTTTAAAATT. Insertion Sequence: CACGACTTCCTGTTTCTTCAGAAAAACTCTGAATGGCCGTTTCCCATTTTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1828 |
tag-164&abcf-2(ok2388) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y76A2A.1, T27E9.7. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2388 homozygotes (small, sickly, tends to die out but populations are possible to maintain). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAAGCAGTTGATAGCCTCG. External right primer: CGTCGCTTTTTCCGTGTATT. Internal left primer: ATAGCTGTTTCATCGGGCAC. Internal right primer: AATTTAGGGTACCCCATCCG. Internal WT amplicon: 3031 bp. Deletion size: 1245 bp. Deletion left flank: CAGGCTAAATTAGCATATTTACACAGACGA. Deletion right flank: CCGCTTGAAGAGCAGTTTTCTCTGAAGCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1831 |
vha-16(ok2332) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C30F8.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2332 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAGATCCAGGAAGGAATGA. External right primer: CGAAAATAATTGCAGCCCAT. Internal left primer: TTGCGAAGCCGATTTAGTTT. Internal right primer: TTCTTTCGCCTCCTTTTTCA. Internal WT amplicon: 2112 bp. Deletion size: 831 bp. Deletion left flank: TTTCGAAAAACCAGGCCGTAAACTGACAGC. Deletion right flank: TTTTTTTTCAAATTAAATTATTATACAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1833 |
sem-2(ok2422) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C32E12.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2422 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGAATGAAAACTGGCTCG. External right primer: ATATGATGCCGCCGATTAAC. Internal left primer: CAATCGCTTGGATTTGTTGA. Internal right primer: CAATTGCAGTAGCCTCATCG. Internal WT amplicon: 3044 bp. Deletion size: 2389 bp. Deletion left flank: AAGTTGGTGCTGGTGATGGTGCGAAGTGGT. Deletion right flank: CCAGAAGTCGATGAGGCTACTGCAATTGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1835 |
T28D6.6&pen-2(ok2449) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
T28D6.9, T28D6.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2449 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGTCGTTTCTCGCTTTTT. External right primer: CTACGTGGAAACCGTGGAGT. Internal left primer: CCCGTGTGCCTGTAAGTTTT. Internal right primer: CTTAAAGGCGCATATCCCAA. Internal WT amplicon: 2150 bp. Deletion size: 1227 bp. Deletion left flank: TCCAGATATTGCCATAAATTTAGAGAAAAT. Deletion right flank: TTCGATTTTTTTCTGAAAAATTCAAAAATT. Insertion Sequence: ATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1847 |
T28D6.6&pen-2(ok2395) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
T28D6.9, T28D6.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2395 homozygotes (grotty sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGTCGTTTCTCGCTTTTT. External right primer: CTACGTGGAAACCGTGGAGT. Internal left primer: CCCGTGTGCCTGTAAGTTTT. Internal right primer: CTTAAAGGCGCATATCCCAA. Internal WT amplicon: 2150 bp. Deletion size: 832 bp. Deletion left flank: CGGCCTCGATATCCGCGATTTTTTGCAAAA. Deletion right flank: GATTTTTTTCTGAAAAATTCAAAAATTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1848 |
mom-5(gk812) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
T23D8.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk812 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGTGTGTGCTCCGTTCTCTC. External right primer: AATCGGTCGAACTGGATACG. Internal left primer: GCACTTGGAACCAATGTCAA. Internal right primer: AATGAACATTCAGGAAGGCG. Internal WT amplicon: 1742 bp. Deletion size: 567 bp. Deletion left flank: TTTTAGCTATTTACTTAAGTTCGGTTTTTT. Deletion right flank: AAAAGTTTGGATTTCAATGGCCAGATCAAT. Insertion Sequence: GAAAAAGTTTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1868 |
F39H11.1(ok2247) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F39H11.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2247 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACTTCGTCGTGAGCATTCA. External right primer: ATTCTTAACCGTGCGACACC. Internal left primer: CATCATAAAGCATGTGCGCT. Internal right primer: TGTCGCTGCTCAGAAGAAGA. Internal WT amplicon: 2222 bp. Deletion size: approximately 400 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1875 |
dnc-2(ok2249) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C28H8.12. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2249 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCACTGACCCGATTTCTTG. External right primer: AACAATCGAACGTTTTTGCC. Internal left primer: AAATGTGATAGTCCACCGGC. Internal right primer: CCGGTAGAGCGCAGTAACTC. Internal WT amplicon: 1224 bp. Deletion size: 707 bp. Deletion left flank: TCAAGTTTGGTAAGCATCATATTCAAACGT. Deletion right flank: TTTTCAGGTTCACTTTTTTGAACTTGACTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1885 |
spe-11(ok2213) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F48C1.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2213 homozygotes (sterile, lays unfertilized oocytes). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTGGGTGCAAAACAGGTTC. External right primer: GGCTTACAGCTCTTGGTGGA. Internal left primer: GACCAAATTGAAGCGCATTT. Internal right primer: GAACATTTTTCCGTCAACCG. Internal WT amplicon: 2133 bp. Deletion size: 1051 bp. Deletion left flank: TGGGATGAATTTATGTGCAACATGCTCGTA. Deletion right flank: ACATTTTTATCATTATAACGAATATTCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1886 |
sbp-1(ok2363) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y47D3B.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2363 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATGCCACTTGTTCAGGGTT. External right primer: GCATGAGAGTTACACGCGAA. Internal left primer: TGGAGACATGTACCCGTTGA. Internal right primer: ATCACACGAGCCCTCAGAAC. Internal WT amplicon: 2759 bp. Deletion size: 1315 bp. Deletion left flank: TGCTTGATAAGACCCCCCTCTACTGCAACA. Deletion right flank: CAAAATCAGAACTCAAAAGCAAAGAAGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1898 |
Y66D12A.24&tin-10(ok2400) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y66D12A.22, Y66D12A.24. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2400 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGCTCACTTGACACTTTCG. External right primer: TGGGGAAAATCGAAAACTTG. Internal left primer: CTGTGCAATTTGTGATTGCC. Internal right primer: ATATGTACCGCCGAATGACC. Internal WT amplicon: 2686 bp. Deletion size: 1690 bp. Deletion left flank: TTCATTTTGGCTAATTTCTCAGTAAAAATT. Deletion right flank: TTCGATTTAAAAAAAATCGATTTTTTTCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1906 |
ceh-45(gk1015) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
ZK993.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1015 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAATGGAGAGACGGGTGTGT. External right primer: TTGAAAATTGTGAAGCTGCG. Internal left primer: GGCGCCAGAGTTTGATCTAC. Internal right primer: AGGTTGATGTGGACGGAGAG. Internal WT amplicon: 1907 bp. Deletion size: 1113 bp. Deletion left flank: CAAAATCTTGGTAGTCTAGAAAACCCCAAT. Deletion right flank: CATGGTGTCCTAGGAATATTTTTAAAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1910 |
ncl-1(ok2555) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
ZK112.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2555 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGCCAATATGGGACTCTC. External right primer: GGATGATACGGCTTTGTGCT. Internal left primer: AGCCATTCCTGTTCCAAATG. Internal right primer: GATTGGACTTCCTCCGTGAA. Internal WT amplicon: 3295 bp. Deletion size: 1644 bp. Deletion left flank: AACAAATGCTCAAAATGGAGCAATTGATTG. Deletion right flank: TTCTCTCGTAGATTGATGTCCTTCGCGTCG. Insertion Sequence: AATTCTCAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1930 |
mrps-30(ok2469) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
B0511.8. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2469 homozygotes (late larval arrest or sterile adult, Unc, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAAATGCCTATCGAGACC. External right primer: CCCGAATCTCCTAATGCTCA. Internal left primer: AGCATTTTTCTGCGTCCCTA. Internal right primer: ACACGCCCTGCTACTGATCT. Internal WT amplicon: 2582 bp. Deletion size: 1317 bp. Deletion left flank: GAACACTCAAATATTGTCCATTTTTATCAC. Deletion right flank: GTGTGTCTTCATCAGAAAAGTTGATTCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1932 |
T07A5.5&unc-69(ok2448) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
T07A5.6, T07A5.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2448 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACGTGTAACCACTTCTCGCC. External right primer: CTTCATCGATCGGCTTTTGT. Internal left primer: CGGCTGTGAACTCATGACATA. Internal right primer: ATTCAAAGCTCGAGCCAAAA. Internal WT amplicon: 2903 bp. Deletion size: 1464 bp. Deletion left flank: GAGCATGAGCATCGCGATTCCAAGAATGTT. Deletion right flank: ATATTTAGTGTAGTAAAACTGTTACGAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1946 |
pbs-6&cids-1(ok2511) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C02F5.4, C02F5.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2511 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAGCGGTACTTGTGG. External right primer: CTTTCCTGCATCAAGCATCA. Internal left primer: TTTCTTCAATTGGAGGACATCT. Internal right primer: ATTCCAGGAAGATCGAGCAA. Internal WT amplicon: 2526 bp. Deletion size: 1604 bp. Deletion left flank: AATACTGGCTTACAAAATTTGAATCTTCTC. Deletion right flank: GAAGATCGAATCAAGGCAGATTTGTTAGAG. Insertion Sequence: GAATCAAGGCAGATTTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1947 |
nuo-4(ok2533) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
K04G7.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2533 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAACCCAAACGTGGCAATA. External right primer: TTGTTAAGACCATCATGCCG. Internal left primer: AAAAGTGTGCGTGGGGTAAT. Internal right primer: GTTCCATGAGCAAATTGGGA. Internal WT amplicon: 3154 bp. Deletion size: 1369 bp. Deletion left flank: TATGTCTTTCAGTATATCAAAATTAAAAAT. Deletion right flank: ATGAACAACTCCTCTGACTTGATTTGAGAG. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1948 |
R151.8(gk1047) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
R151.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1047 homozygotes (sterile, does not lay eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCGTGGTCTTCTTCTTCTG. External right primer: AGTTCTTCTCGACGACGCAT. Internal left primer: GAGATGCATGTCGTGTCGAT. Internal right primer: ATTGTTTCAGCACGGGAAAG. Internal WT amplicon: 2188 bp. Deletion size: 1135 bp. Deletion left flank: GGTTCTTCTCGGAATTATTGTAGTTTTTGG. Deletion right flank: GTAGAATCTCCTGCCAATGACCATTTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1955 |
lin-12(ok2215) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
R107.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2215 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCTTTTCTCGCAGCTCCA. External right primer: CATACATTTGCGTGTGTCCC. Internal left primer: GGGCTGTCATTCCGTTTCTA. Internal right primer: AAACCTGGGAACACATCGAC. Internal WT amplicon: 3327 bp. Deletion size: 1227 bp. Deletion left flank: ATTAATTCTGTTGGTGTGGTTTGGTTTTAT. Deletion right flank: GATTTCTAGAAAACAAACTGGTTGCTTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1961 |
F26H9.8(ok2510) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F26H9.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2510 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAACATCCCATCCCGAATA. External right primer: CCATTTCACGAATTTCGGTC. Internal left primer: GTGACCCTTCGAAAAGTGGA. Internal right primer: TTTCAGTTTTTGGCACGTTTT. Internal WT amplicon: 1143 bp. Deletion size: 783 bp. Deletion left flank: CAAGTGGAGGTCATCCTCGATTTTGGCCGA. Deletion right flank: CAAAATTCTAAAAAATCGGCACTTGGAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1962 |
pbs-6&cids-1(ok2516) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C02F5.4, C02F5.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2516 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAGCGGTACTTGTGG. External right primer: CTTTCCTGCATCAAGCATCA. Internal left primer: TTTCTTCAATTGGAGGACATCT. Internal right primer: ATTCCAGGAAGATCGAGCAA. Internal WT amplicon: 2526 bp. Deletion size: 1268 bp. Deletion left flank: GTGGTGAGGATGATGTTATCATTCCTGAAT. Deletion right flank: CGTTGAAGAAGCGAAAAAGAATGCACAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1966 |
apm-1(ok2578) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F55A12.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2578 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAGGGATGACTGTTTTGGC. External right primer: ATTACGGCTTCCACGTTTTG. Internal left primer: TGGCTTGAAGGATATTGGGA. Internal right primer: ACATGTCGATTTCCGGTCTC. Internal WT amplicon: 2261 bp. Deletion size: 1825 bp. Deletion left flank: TAAAGATAATATAGAAAAAAAAAATTTCGG. Deletion right flank: AAACTCACATTTCCTTTGAGGTCCAAGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1987 |
F52C9.3(ok2530) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F52C9.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2530 homozygotes (sterile with few eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCGGAGCAGTTGATACACAA. External right primer: TAGTTCCCTAAAACGTGGCG. Internal left primer: TTGGAACTGTTGTCACTGGC. Internal right primer: GGATGTTGGCAGGAAAATGT. Internal WT amplicon: 3134 bp. Deletion size: approximately 1000 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1994 |
ncbp-2(ok2496) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F26A3.2. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2496 homozygotes (probably viable Dpy, sometimes blistered, often sterile). Use care when maintaining - viable WT non-GFP animals are most likely rare recombinants. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAAATTTTCACCTGCCTCA. External right primer: AAGGAATAAGGGGGTCATCG. Internal left primer: GCATGCAGCACTAATTTCCA. Internal right primer: TGTAGTCCAACATTGGCGAG. Internal WT amplicon: 2328 bp. Deletion size: 1024 bp. Deletion left flank: AAAAGTTGTTAAAACAAAAGGCTTACCTGG. Deletion right flank: GACAAAAGGATAAAGTCGACATTTTTCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC1999 |
eif-3.E(ok2607) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
B0511.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2607 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATCTCCGTGTTTGCCACA. External right primer: GATGAGAAATCCCTGACCGA. Internal left primer: TCGCCTTGACTTTGTCTTGA. Internal right primer: GACTCCGTTGTTGCCATTTT. Internal WT amplicon: 1140 bp. Deletion size: 578 bp. Deletion left flank: GTTCAGCTTCCTCTTGGCTCATATTCAATC. Deletion right flank: CCATTCTTGGAGCAGAATTTCACTGGCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC2005 |
ZK973.9&lpd-5(ok2652) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
ZK973.10, ZK973.9. Homozygous lethal/sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2652 homozygotes (late larval arrest or sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTTGAGGCTGTTGTTGGTT. External right primer: GAATCGGCGCTACTCATCTC. Internal left primer: GCAGCGGTACCATCATCTTT. Internal right primer: TTACAACGGGAGACAAAGGG. Internal WT amplicon: 2218 bp. Deletion size: 1384 bp. Deletion left flank: ACTCCTTTTTTGCAAAAAAAAACAAACAAA. Deletion right flank: TGCTTGTACGAGAACACATACCATTCCCTT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC2018 |
F16D3.4(ok2634) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F16D3.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2634 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCGGGAGATTCAAATAAGG. External right primer: TTTTGCAGCAATGGATGAAG. Internal left primer: CAAAACGCGTCTCCATTTTT. Internal right primer: ATGCACCAGTCGATGAGTCG. Internal WT amplicon: 1161 bp. Deletion size: 464 bp. Deletion left flank: CCGTCAAAACTCTCCGATCAACGTGTTTGA. Deletion right flank: CGTACAATACACAAATCAGAAAGATATTTC. Insertion Sequence: CAAATACACAAATCAGAAAGATATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC2019 |
B0336.3(gk910) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
B0336.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk910 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTACCCCATTGGTTCCTCCT. External right primer: TCAATTCCATCTCGAGGTCC. Internal left primer: ATTCTCGCATTTCTTTGCGT. Internal right primer: ATTTGGGCTGCAATCTCATC. Internal WT amplicon: 2166 bp. Deletion size: 408 bp. Deletion left flank: ATGGTTCCACTCCCGGCTACCGCTCCTAAT. Deletion right flank: CTTCAAGTTGCCAAGATTCCACCAGAGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC2031 |
R07E5.1(ok2653) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
R07E5.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2653 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTTTTTGGGCCATTTTGAG. External right primer: CCATTTTCACAGCGGCTAAT. Internal left primer: AATTAATTTTTCCAGGCGGC. Internal right primer: CACAAATTTCGAAGCCATCA. Internal WT amplicon: 1186 bp. Deletion size: 399 bp. Deletion left flank: ATTTGCTAAAGTTTGAGTTTACGGGTTTTT. Deletion right flank: CTGTCTGGGAGTGGGAGTGGGAAAAGAAAG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC2053 |
wip-1(ok2435) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
R144.4. Homozygous sterile or near-sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2435 homozygotes (grotty, Unc, with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGTATTCCGAAGTGCGAC. External right primer: CCATGAAGAAACCCAGGAAA. Internal left primer: TCAGAAAGATTGTTCCGGTTTT. Internal right primer: GGGGGATTGACGGACTATTT. Internal WT amplicon: 3053 bp. Deletion size: 1544 bp. Deletion left flank: AAATAAGACGGTAAAGAATTTTATCAGAAT. Deletion right flank: TCAGTTCCAAGCTCAAAACCGACTCCACCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC2100 |
Y56A3A.2(ok2738) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y56A3A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2738 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTAAGCTCCGCCCATTTCT. External right primer: AACATCAATTTTGCCGGAAG. Internal left primer: GCTATTTCGCACTAAAATTGTTCA. Internal right primer: GAAGTTTCAATTCCGGCAAA. Internal WT amplicon: 1156 bp. Deletion size: 411 bp. Deletion left flank: ACGTTCGAATACACCTCCACCAGTCGGCAA. Deletion right flank: GTGCCAGAATTTGAATTTCCGGCAAATCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC2105 |
arx-5(ok1990) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y37D8A.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1990 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGGATTTTTCTGCGTCTC. External right primer: GGCCAATATGCTTTTCGTGT. Internal left primer: GATACCGTGGCGTTTTTGTT. Internal right primer: CGGGTCTCAACACGAAAAAT. Internal WT amplicon: 2347 bp. Deletion size: 879 bp. Deletion left flank: ATAGAGATTTCGCGTATTTCGCGCACAACA. Deletion right flank: AAAAATCTGTTTTCGGTAGGAATGTTCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC2111 |
rha-2(ok2639) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
C06E1.10. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2639 homozygotes (grotty sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGCCAATGTTTTTCCGAGT. External right primer: TTCCACTTCGTTCCAAAACC. Internal left primer: CGTGATTCTTGCTTCCGTTT. Internal right primer: GTTATCAAAGTTGACGCCCG. Internal WT amplicon: 1103 bp. Deletion size: 558 bp. Deletion left flank: TCTGGAAATTAGCTTTTTTATTCTATAAAT. Deletion right flank: AGAATGGCACCCGGTGGTAGAGTTTCATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC2112 |
Y71F9AL.17(ok2824) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
Y71F9AL.17. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2824 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTTTGACTTTTGCCCCCTT. External right primer: TCAGCAAGGATGTTGCTCTG. Internal left primer: AGCTGTCTGGAAATGTCCGT. Internal right primer: CTCCGTTACCCACAACCATT. Internal WT amplicon: 1146 bp. Deletion size: 766 bp. Deletion left flank: TGACAAGCTTATCCGTATTTCCAGTAACAA. Deletion right flank: AGCCGTGTTGATATTCTCGAGTTTGCGAAG. Insertion Sequence: GATACAAAAACGAGAGCTTCTCAAAGTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC2120 |
W03G9.5(ok2325) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
W03G9.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2325 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTCTGCACATTTTTCTCG. External right primer: CCGTGAAATTCCCAGTGAAC. Internal left primer: GAAACTTGGAAAACCGCAAA. Internal right primer: GGATTTGCCGAAGATTCAAA. Internal WT amplicon: 2805 bp. Deletion size: 790 bp. Deletion left flank: ATTATTAATATTGAGCTCCCCCATGCCTGC. Deletion right flank: TTCCATTATTCCCGTCCTGAAAAAAAATGA. Insertion Sequence: TCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC2164 |
sdz-1&vps-33.1(ok2494) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
B0303.8, B0303.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2494 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAGCCCTGGAAGACATTGAT. External right primer: AGTGAAACCATTGTCGGAGC. Internal left primer: ACCACCATACGGATCTCCAA. Internal right primer: CGGACTTTTTGGTTTCGATT. Internal WT amplicon: 2348 bp. Deletion size: 1060 bp. Deletion left flank: GAGTTTGGTATCCAGGTGTTGAAGTTTGAA. Deletion right flank: ACTGGGAAGGGACTGTTAGTTTTCTAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC2166 |
nuo-4(ok2483) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
K04G7.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2483 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAACCCAAACGTGGCAATA. External right primer: TTGTTAAGACCATCATGCCG. Internal left primer: AAAAGTGTGCGTGGGGTAAT. Internal right primer: GTTCCATGAGCAAATTGGGA. Internal WT amplicon: 3154 bp. Deletion size: 1295 bp. Deletion left flank: TCTATTACTTAAAGCAAATTTTCAAATTGA. Deletion right flank: AGTCTAGAAACAATTATTTTGAAAGAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC2183 |
ncbp-1(ok2787) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
F37E3.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2787 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGAAAAATATCGGGCTTCAA. External right primer: CCTTCCAATCTGTCCAGGTG. Internal left primer: GCCATCTATCTCCCAAATCG. Internal right primer: ATTAAACCCCCGCTAAATCG. Internal WT amplicon: 1121 bp. Deletion size: 534 bp. Deletion left flank: CTCAAAATCTTGCTATTTTCCTTTGTGATC. Deletion right flank: GCGGATTGTTCCGCCTTTTCTGTAAGTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
VC2189 |
K10D2.4&cid-1(ok2757) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). |
C. elegans |
K10D2.4, K10D2.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2757 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 713 bp. Deletion left flank: AGGCTGAAACAACCTTCATTTTACTTTTGC. Deletion right flank: AATGAAGTATATTAGGCCCTTCGTATTGCT. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |