Variation Information: e937

Namee937 View on WormBase
Species C. elegans
Genetic positionI:1.02 +/- 0.000 cM
Genomic positionI: 6345831..6349156
Protein changeK04F10.4a K04F10.4b K04F10.4c K04F10.4d K04F10.4e K04F10.4g K04F10.4h K04F10.4i K04F10.4j Deletion

Strains carrying this variation

Strain Genotype Species Description
VC1167 sulp-6(ok1586) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans W01B11.2. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1586 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGTTGGAACAGTTGTGGAA. External right primer: TTCATGTCTATTCGCCCACA. Internal left primer: TGGCTCAACAAATGGAACAA. Internal right primer: TTCGGTATTTCCGCATCTTC. Internal WT amplicon: 3052 bp. Deletion size: 1653 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1185 tag-72(ok534)/hT2 I; hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C25A1.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok534 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1191 pab-1(ok1656) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y106G6H.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1656 homozygotes (probable early larvarl arrest ). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGTTTGCGATTCATTTCA. External right primer: CTAGACGTCGCCTGACTTCC. Internal left primer: GTTCAACATGTGTTGGTCCG. Internal right primer: GACCCAACTCCTCACCCATA. Internal WT amplicon: 2732 bp. Deletion size: 1938 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1201 unc-89(ok1658) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C09D1.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1658 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCAAGTTCTTTTCGGGTTGG. External right primer: AGCGAAAGAGCAGCATGATT. Internal left primer: TCAAACAGCGCATGAAAAAC. Internal right primer: TACCCAAAAACGGAAAATCG. Internal WT amplicon: 2637 bp. Deletion size: 1274 bp. Deletion left flank: TCCTATCATCTATTTCATTCGATCAAACAA. Deletion right flank: ATTTTGGGGGGGGGGGGGGGCAGAAATCGG. Breakpoints should be confirmed; deletion may also involve insertion and/or rearrangement of sequence between external left and internal left primers. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1213 gei-8(ok1671) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C14B9.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1671 homozygotes (mid-larval arrest, Dpy). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCAGTGCTGGATACTGCAAA. External right primer: GACAAGTTGGTTGGACGGAT. Internal left primer: GGTTTACCCTGTTGCGAAAA. Internal right primer: CATCACCGACACTTGATTGG. Internal WT amplicon: 3299 bp. Deletion size: 1095 bp. Deletion left flank: AGCTTGTGGAAACTGAGGAAATTGATATTT. Deletion right flank: TGTGCCTGTGGCTGCTGCTGCTGTTGTTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1215 rga-2(ok1683) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y53C10A.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1683 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTGCATTTTAGCTGTGGCTG. External right primer: TCCAATGAGCTTTTTCGGAC. Internal left primer: TGTGGCTGCTCATCTTGTTC. Internal right primer: CCTATGCTGAGCCTCTGTCC. Internal WT amplicon: 3209 bp. Deletion size: 930 bp. Deletion left flank: CGGCAAATCTAACTATTTATAAGTGTAAGA. Deletion right flank: GCTCCAAAATGAATGCTTCATCCTTATCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1245 smc-3(ok1703) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y47D3A.26. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1703 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1248 gmn-1&Y75B8A.18(ok1708) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y75B8A.17, Y75B8A.18. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1708 homozygotes (mostly sterile; occasional progeny arrest as larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TACTTCGTTTCGAGCGTCCT. External right primer: AGTAGGCCGTCAAATTGGTG. Internal left primer: TCCGCCGTCTCTTCTATTGT. Internal right primer: AACAATCCTGTTCCGCTCAT. Internal WT amplicon: 2898 bp. Deletion size: 1490 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1250 pcaf-1(ok1690) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y47G6A.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1690 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGAAATCCCTTCGCACACT. External right primer: ATTGGCATTTTTCTAGCCGA. Internal left primer: GCGAAAAACAACGATTAGCC. Internal right primer: CTGGAACTTGGAAACTTGGG. Internal WT amplicon: 3142 bp. Deletion size: 1258 bp. Deletion left flank: CTACAGGAAGAGGAGAGTGGGCTCATTGAG. Deletion right flank: TTTGCCCATTTTTGCTAAAATTGAACCAAA. Insertion Sequence: CCCATTTTTGCCCATTTTTGCCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1251 rae-1(ok1720) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F10G8.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1720 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATACATTCGAACGCGACACA. External right primer: CCAGAAACGCGGTTTAACAT. Internal left primer: GCGCTCTACTGCCAATTTTC. Internal right primer: GGAAAGCACCCGAACTATGA. Internal WT amplicon: 2465 bp. Deletion size: approximately 750 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1279 sep-1(ok1749) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans ok1749. Homozygous sterile deletion chromosome balanced by bli-4- let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1749 homozygotes (sterile Unc adult, often with mid-body constriction). Homozygous hT2[qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCGTTTTGTACGTCGATTT. External right primer: TCGGATCCTACTCGCTCATT. Internal left primer: AATCGCTCCCAACAGAATTG. Internal right primer: TTATTTCAGTTCCCGGATCG. Internal WT amplicon: 2960 bp. Deletion size: 1234 bp. Deletion left flank: TTTCTCAACTTTCGGACGACGTCCGAACGG. Deletion right flank: GGAAATTGATACGTTATTTTTAAGAATGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1280 kin-10(ok1751) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T01G9.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1751 homozygotes (grotty adult, dies). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTCGCAAAATTTCACGTTT. External right primer: TTCGACAGAAAACTGCTGGA. Internal left primer: GTGACGAAGACAGGCACAAA. Internal right primer: TTCACCCAACCTGTACCCAT. Internal WT amplicon: 2149 bp. Deletion size: 1452 bp. Deletion left flank: TCTTGAGTTTTGTCGGAAAAGAAAATTTTG. Deletion right flank: TTGAGACCTGTCAAATTGAACCGATCCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1308 eef-2(ok1774) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F25H5.4. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1774 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTGGCGCTCTACCGTACTTT. External right primer: AGGCCGAAACAAATTCAATG. Internal left primer: GCAAATTTTGGGCCTACTGA. Internal right primer: AAACGATCTGGTTTGGCTTG. Internal WT amplicon: 2855 bp. Deletion size: 1443 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1315 T10F2.4(gk575) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T10F2.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk575 homozygotes (sterile with no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACACGTCACCAATGAACGA. External right primer: CGTGGTGTCTCGAATTCCTT. Internal left primer: CATGTCGAAGGACAGGGAGT. Internal right primer: TTCGTTTATGTCCCACGTCA. Internal WT amplicon: 1565 bp. Deletion size: 632 bp. Deletion left flank: TGAATGTTTGCATAACCTGTTCCTTTTCAT. Deletion right flank: AGATAATTGCAAGGTTGACAAACCTGGTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1325 tbg-1&F58A4.9(ok1786) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F58A4.9, F58A4.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1786 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTCGTTGTTGCGGAATTTT. External right primer: CGCCGAGTTCAAAAAGAAAG. Internal left primer: CTTTCTTCGGAAATGCTTCG. Internal right primer: GCTCAATGTGTTCGCAGAAG. Internal WT amplicon: 2187 bp. Deletion size: 1269 bp. Deletion left flank: GGCTTGAGCAAGCTGATTTCCGCACTGTCC. Deletion right flank: GAGTAAGAAAAAGAAGATCAAAGTGGATAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1343 plk-1(ok1787) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C14B9.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1787 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTAGCACCCTTTTTCATCGG. External right primer: GCAGATCCCATTGGCATAAT. Internal left primer: AATCGACTTCCCAACATTGC. Internal right primer: TGGGACTAAAAGGGTCGATG. Internal WT amplicon: 2510 bp. Deletion size: 1798 bp. Deletion left flank: AAGGCGGTCACCGAACCTGAAGCTCGTTAT. Deletion right flank: GCCACGGTCAATGGCAGCTGCTCGTTCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1344 T09B4.9(ok1792) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T09B4.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1792 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTTTCAGGCATTATCCA. External right primer: TCAAAATTGCATCACTGGGA. Internal left primer: TCTTCGCTCCGAATTGAACT. Internal right primer: TTGTGGAAACGGGATACGAT. Internal WT amplicon: 2834 bp. Deletion size: 1635 bp. Deletion left flank: AAAAGTTGAGATTTAATTAGGACACTGAGA. Deletion right flank: TTCTCCAAATCGAACCCATCTGTCCGTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1346 F59B2(ok1801) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F59B2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1801 homozygotes (sterile, Dpyish). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGGCTCAGCAAGAAAATGAG. External right primer: GTGCTCGATGTCCACACAAC. Internal left primer: ATACCGCCTGCAATTTTCTG. Internal right primer: GCTTTTGAAATCGAAGCGAC. Internal WT amplicon: 2606 bp. Deletion size: 829 bp. Deletion left flank: TTAACAAGAAAAAATGATTTTAAAACCGTG. Deletion right flank: AAAAATTAACATGTCGAGAACCTAAGTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1350 imb-3(ok1795) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C53D5.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1795 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGGGGGAACAATGAGGACT. External right primer: AACCTCATCGACGATTCTGG. Internal left primer: GGGAGAAGTGGTGGAACAAA. Internal right primer: TGTTATCGCTTTCGCTGTTG. Internal WT amplicon: 3104 bp. Deletion size: 1411 bp. Deletion left flank: AGATTCTCGGAAGATTCTGATTTTCTGGTC. Deletion right flank: TTCATTCCGTCTCCGAGAAGGTTCAGGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1359 K02B12.3(ok1827) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans K02B12.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1827 homozygotes (probable embryonic/early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAATGGAGAAGGATGGACCC. External right primer: TGGAACAAGAACCGGAAAAC. Internal left primer: TGAGAAATAGTGAAGCGCGA. Internal right primer: CTATTTGAACACCCGCCAAT. Internal WT amplicon: 2550 bp. Deletion size: 1420 bp. Deletion left flank: AAAATTCGGATTTAATTATTTAGATAGAAG. Deletion right flank: CCACGTGTTCTCGTTGAAAATCGCTTTCGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1360 Y48G1C.7(ok1850) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y48G1C.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1850 homozygotes (sterile with no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGGGTCGACTATCACATCA. External right primer: CTCGCAGAGCTCACAAAGTG. Internal left primer: CACAACCACTTGTTCGAGGA. Internal right primer: CGCGTGTAGGATCCATTTTT. Internal WT amplicon: 3378 bp. Deletion size: 985 bp. Deletion left flank: AATTAGATAAAAATTGGATTTTCAGCACAT. Deletion right flank: TTTTTTACTTTCGGAACGTCCCACTTTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1391 cdc-25.1(ok1888) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans K06A5.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1888 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGGAGACCTGCAAAGTGT. External right primer: AAAAGTGGCTTGTTCATGGG. Internal left primer: GTGCTATTATTCGGCGTCGT. Internal right primer: TCAATCACGGTCCTTTTTCC. Internal WT amplicon: 2246 bp. Deletion size: 1512 bp. Deletion left flank: CCTGGAGCCCAAGTTGAACAATGCGCTCTT. Deletion right flank: ATCATAGTTGTAGCTGAAAATTGTTTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1393 hcp-3(ok1892) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F58A4.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1892 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCTTGCACGATGCTACCTG. External right primer: AAACAGAGCGATTAGCCGAA. Internal left primer: CGTGGTCAATTTCAGAGCAA. Internal right primer: ACTCGGTTAGCAGGCACACT. Internal WT amplicon: 2320 bp. Deletion size: 1169 bp. Deletion left flank: CTTGAAGAGCACTGATGGCGTCAGAACGAA. Deletion right flank: AAATATTCCATCAAAACTTCACGAAACTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1395 mdt-30(ok1791) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F44B9.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1791 homozygotes (late larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACAATGCGTTGGGTATCAG. External right primer: TCCCAGATGAAGCAATGTCA. Internal left primer: TCAGCCGCCAAGTTTTTAAC. Internal right primer: CAATGAATCCGAATCAACCC. Internal WT amplicon: 2678 bp. Deletion size: 1412 bp. Deletion left flank: CTTGATTCAATGGCTTCCGTTCCATTACTT. Deletion right flank: GAGTAAAAAAGTAAAATTTCGTGTTTGGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1400 cdk-1(ok1882) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T05G5.3. Homozygous sterile deletion chromosome balanced by bli-4-, let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1882 homozygotes (sterile Unc with withered tail). Homozygous hT2[bli-4 let-? qIs48] normally inviable; occasional recombinants are seen (Bli, bright GFP). Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACTAAGCAATGGTCTCGCA. External right primer: CGACAACAATGGAAACATCG. Internal left primer: CGCTTACGCCTTTTCTATCG. Internal right primer: ACCATTCTCTCGTGAATCCG. Internal WT amplicon: 2136 bp. Deletion size: 764 bp. Deletion left flank: TCGACAACAATGGAGCAATCAAGCTTGCCG. Deletion right flank: CGATAAATAAATTCGCTCTACTTTCATGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1417 T10F2.4(gk647) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T10F2.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk647 homozygotes (sterile with no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACACGTCACCAATGAACGA. External right primer: CGTGGTGTCTCGAATTCCTT. Internal left primer: CATGTCGAAGGACAGGGAGT. Internal right primer: TTCGTTTATGTCCCACGTCA. Internal WT amplicon: 1565 bp. Deletion size: 820 bp. Deletion left flank: ATCAGCAGAAGCAGAGATTGCAGTAATATT. Deletion right flank: GAGACTTGAGAGACGACTGGGTCTTCGGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1421 hmg-1.2(ok1906) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F47D12.4. Homozygous lethal deletion chromosome balanced by bli-4-, let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1906 homozygotes (Dpy, larval arrest). Homozygous hT2[bli-4 let-? qIs48] normally inviable; occasional recombinants are seen (Bli, bright GFP). Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGACTCGCAACCCTCTTCT. External right primer: ATTGTCAACAGAGAACCGGC. Internal left primer: CTATTCGCGTGATCTTGTGC. Internal right primer: ACTTTGGGCTCTTCTGGTGA. Internal WT amplicon: 2101 bp. Deletion size: 759 bp. Deletion left flank: ATTCTGGTTACAGCGCAAACATTTTTCCCA. Deletion right flank: AAAAGAGCCCTGTAAGTTTTTTAAAGTTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1423 ucr-1(ok1909) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F56D2.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1909 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAGCTACGCGCAGGATAAA. External right primer: TTGATGGGCAGACAATCTCA. Internal left primer: TAAACTTTCGGTGGGTCTCG. Internal right primer: TTTCTGGCACAATTCGTCAA. Internal WT amplicon: 2410 bp. Deletion size: 1548 bp. Deletion left flank: ACTCGCCGTCAGCTCTGCTTTGCGTCCGGC. Deletion right flank: AGAACCAATTCAGAACCAACTTGTACCAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1431 K06A5.4(ok1924) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans K06A5.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1924 homozygotes (Dpy, larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGGCAAAATCGTAGGAACAA. External right primer: TTCAACGCCTTCTGAGTTCC. Internal left primer: GCCTAATGGGTGATACGGAA. Internal right primer: TCCTTTGCCTTCGTTTGTTC. Internal WT amplicon: 2805 bp. Deletion size: 2034 bp. Deletion left flank: GCTGAAGCTGAGGCTGAAAGAAGGCGAAAA. Deletion right flank: ATTAGTTTTAAAAAAGCATTAATTTTTCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1439 skr-2(ok1938) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F46A9.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1938 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCAAGCCAAATTGAATGGTT. External right primer: TTCCTTCTTCGTCGTCGAGT. Internal left primer: CGCGACATAAAAATGCACAC. Internal right primer: CACACAAAGGAAGAGACGCA. Internal WT amplicon: 2146 bp. Deletion size: 1107 bp. Deletion left flank: GGTGCACCAAACACCAGTCCGACCCAATTC. Deletion right flank: GTTCTATAACGATCGATAACTCTGCGTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1440 ran-2(ok1939) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C29E4.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1939 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGCAGAATCACTGAAAACG. External right primer: CCCAATCAGTTTCAGCCTGT. Internal left primer: GCTCTTGGAGAGGCATTGAC. Internal right primer: CGGCGGACGATATTTTCTTA. Internal WT amplicon: 2901 bp. Deletion size: 2075 bp. Deletion left flank: GACAAAATAAATCGAGATTGTCTGAAGAAA. Deletion right flank: ACGTGTTATTCTTCAACTTTCAGCACCTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1441 ceh-6(gk665) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans K02B12.1. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk665 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGACAGACGAATGCAACGA. External right primer: GTGCCTTCTTTTTCCAACCA. Internal left primer: ACAGAAGAAAGGGCGGAAAT. Internal right primer: CAACTTCCAACTGCTTTGGG. Internal WT amplicon: 2295 bp. Deletion size: 1525 bp. Deletion left flank: GAAGGTACATTAGTGAATAGGAAAATAATA. Deletion right flank: AGACATTGATGCTGTAGAATTGTGAAGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1459 npp-15(ok1954) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C29E4.4. Homozygous lethal deletion chromosome balanced by bli-4-, let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1954 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] normally inviable; occasional recombinants are seen (Bli, bright GFP). Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGGCTTCCAATTTGACATCG. External right primer: CCACTCGACTTCCACCTTGT. Internal left primer: CATTCATCTTTCGCTGGGTT. Internal right primer: GTCTGCTGGCTTTCCAAGAG. Internal WT amplicon: 3083 bp. Deletion size: 1597 bp. Deletion left flank: ATACCCGGCACTGGTGAAAGAGGCCTTTCT. Deletion right flank: ATGGCAGAGTCGGAAGAGGAATTAAAGGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1463 gon-2(ok465) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T01H8.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok465 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAGAGGTTAAATCAGCCCG. External right primer: GTTGCTGCATTTGGACTTGA. Internal left primer: TGGTGAATAATTGGCTGCAA. Internal right primer: GATGCTTTGGGTTTGTGCTT. Internal WT amplicon: 2829 bp. Deletion size: 507 bp. Deletion left flank: TAATGGTAATCTGACAGAAAACGATTTTTT. Deletion right flank: AGAACTAGAGATATTTTTTGATAAAAACGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1475 tbx-9(gk666) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T07C3.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk666 homozygotes (sterile). Viable fertile non-GFP progeny are recombinants and not homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTGCAGCGACCACTATGAC. External right primer: CAGAATCGATAGCCGAGAGG. Internal left primer: AATTTAATCGGCGGGTCTTC. Internal right primer: TTTGGCAATGAGGTGAGATG. Internal WT amplicon: 2334 bp. Deletion size: 892 bp. Deletion left flank: AGCGTTGTTGGACTCTGAATAGTTGGAGAT. Deletion right flank: GGAGGAGCGGGAAAACTATTCTAACTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1478 vpr-1(tm1411) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F33D11.11. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1411 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTCCGAGATAATACGGCGA. External right primer: ACGCTTGCCTCTAGGCACTA. Internal left primer: TTGGGGGAACGGGGAACCAT. Internal right primer: TAGGCACTAAGCACTGGCCA. Internal WT amplicon: 1799 bp. Deletion size: 657 bp. Deletion left flank: CCTCGTTCCTAACCGCAAAGGTTTTTGTAT. Deletion right flank: TGTTTTTTTTCTATTGGTATTTACGTACAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1497 fum-1(ok1998) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans H14A12.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+ (heterozygotes), arrested hT2 aneuploids, and non-GFP ok1998 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. External left primer: ACTTGTGCGGGAGAAGAGAA. External right primer: CGAATTAAGCTTTCAAGGCG. Internal left primer: GAACCATGCCGAGTTTGATT. Internal right primer: TGAACATTTGGGGACATTGA. Internal WT amplicon: 2152 bp. Deletion size: 1351 bp. Deletion left flank: ACTTTCGGAGAGCTCGAGGTTCCAGCCGAC. Deletion right flank: TGCTCACAAGAACGGCACCACCCTTGTCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1530 mei-1(ok2000) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T01G9.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2000 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATTGTTTGTCGCGGATGA. External right primer: GATGAAGGTGGCCTTGAAAA. Internal left primer: TGTTTCCAACAAGTGAGCCA. Internal right primer: CAAAAACCAAAGCTAGGCCA. Internal WT amplicon: 2180 bp. Deletion size: 1378 bp. Deletion left flank: ACAAAGAAAGGAGTTGGAGCAGCAGGTCCA. Deletion right flank: CAAAGAATGGTGTGACTCTTTTGGTGCCAT. Insertion Sequence: TGTAAATCAACTATTTATTGTGATCTCCTTTTAGTTTAAAATATTGTGGCCTAGCTTTG GGTTTTTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1533 T23D8.3(ok2016) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T23D8.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2016 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGAAGAGCAAGAAGGCGA. External right primer: GGCGCCAATACTTGTTGAAT. Internal left primer: ACACAATTGAGTCGAAGGGG. Internal right primer: CCGGTTCTGTCCAATCAGTT. Internal WT amplicon: 3212 bp. Deletion size: 1434 bp. Deletion left flank: AGGGAATATAAGGAATATTTTGAGACGGGT. Deletion right flank: ATAATTTTCTTGAAGTTTATTTTTCATAAA. Insertion Sequence: ATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1537 isw-1(ok1951) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F37A4.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1951 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTGCTCGATCACGTCAAAC. External right primer: AGAAATCCGGCAAGCATCTA. Internal left primer: TACAGCTTGCCGGAAAAATC. Internal right primer: TAAACGCCCGAGGTAATTTG. Internal WT amplicon: 2817 bp. Deletion size: 1866 bp. Deletion left flank: TTTCTGGGCTTCCGACATACGACCTTGTTG. Deletion right flank: GCGGCGTCGGACGATTCCGGTTCATCGTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1549 pfd-5(gk706) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans R151.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk706 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGGAACTGGTGCTTTTTCG. External right primer: ACATTGCAGGGAAACAAAGG. Internal left primer: ATAGCAGCGAGACAAGCACA. Internal right primer: TTGAATTACCGCCAACAGTG. Internal WT amplicon: 1648 bp. Deletion size: 587 bp. Deletion left flank: TCGCAGTTTGTCACCGGTTGAACTCTCATT. Deletion right flank: CCTGCAGTTGCAATTTTCACATCGTCCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1575 cgh-1(ok492) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C07H6.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok492 homozygotes (sterile adult, tends to explode at vulva). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCAGCTCGAAAATATTGCC. External right primer: GGAAAACCGCAAGGATGGTGG. Internal left primer: TCACGGAGCTAGATGTGACG. Internal right primer: CGTCAAAAAGAACCCGATGT. Internal WT amplicon: 3095 bp. Deletion size: 1043 bp. Deletion left flank: GAGAACATACACAATCTGGACGAGATCACT. Deletion right flank: CCTGGGGTGGCGATGACCAAGTGAACCGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1609 kin-10(ok2031) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T01G9.6. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2031 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTCGCAAAATTTCACGTTT. External right primer: TTCGACAGAAAACTGCTGGA. Internal left primer: GTGACGAAGACAGGCACAAA. Internal right primer: TTCACCCAACCTGTACCCAT. Internal WT amplicon: 2149 bp. Deletion size: 966 bp. Deletion left flank: AGTCGTGTTGTTTTGTGCTGCGGCAACGTT. Deletion right flank: TGGAAGCATTGGCTGATTTTCACAGTAGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1610 T08B2.5(gk721) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T08B2.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk721 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATTTGGTTGAGACGATCCG. External right primer: AAGGTAACATCGCCATCGAC. Internal left primer: CGTGACATGAGATCAGGCAT. Internal right primer: GCTTGTCAAACCTCACGGAT. Internal WT amplicon: 2344 bp. Deletion size: 914 bp. Deletion left flank: GGAATTGTCTACAGTGGATGTATGAACACT. Deletion right flank: GGTTGCCATCAAATTCAAATTTCCAGGGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1621 T26G10.1(ok2057) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T26G10.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2057 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCACCATCAGCAATATCCA. External right primer: TCCGTTGGACTTTCCAATTC. Internal left primer: TTTTGTCGTCGCTTCTTTCC. Internal right primer: AAGTGTCGTCAGATTGCGTG. Internal WT amplicon: 2101 bp. Deletion size: 1183 bp. Deletion left flank: AGTCGGAAAATTCAAAATCTAACCTAAATT. Deletion right flank: CTCTGAAGACAATTAACCAGTTATTTCAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1622 let-765(ok2058) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F20H11.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2058 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAATCGTATTGCTGCTTCCA. External right primer: CGGAGCTGGTGTAGGAAAAG. Internal left primer: GTCCATTCGAATCTTTCCGA. Internal right primer: TGCTGAACGTGATCTTCGAG. Internal WT amplicon: 3229 bp. Deletion size: 1540 bp. Deletion left flank: CACAGATTCTAGATGAAGTGATAAAATCCG. Deletion right flank: TTTTGAAGTTCTAAGACCATTCGTCCAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1632 C17E4.6(gk787) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C17E4.6. Maternal effect lethal/sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk787 homozygotes (fertile WT whose progeny arrest before reproducing). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTGTGTGAAGAGACGCAGA. External right primer: CCAACCCCAACTGCCTACTA. Internal left primer: AGAGCGCGTTTGCACTAATC. Internal right primer: GGAGCCATAGTCGAGAGACG. Internal WT amplicon: 2178 bp. Deletion size: 796 bp. Deletion left flank: AGAAGGAAGCTCCAATGACGAACATTCAAA. Deletion right flank: ACTGTTTTTGAAGAAACGTTTAAAAAAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1633 unc-120(gk719) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans D1081.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk719 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACTACCTTCACCCCTCCAA. External right primer: CTATAACACGGGACCCCCTT. Internal left primer: GGTCCTTCCATTCCCATCTT. Internal right primer: GGCTGACATAACATCGCTCA. Internal WT amplicon: 2150 bp. Deletion size: 972 bp. Deletion left flank: ATGTTTCTAAAATTTATCTGCATTTTCATA. Deletion right flank: AAATATCCTGACTCACCTATTTAGTTGCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1635 nono-1(gk1206) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F25B5.7. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1206 homozygotes (Unc, nearly Ste, has a few progeny but can't maintain population). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCCCGTGACGAGATATCAG. External right primer: TCAAATTGCAACTCAACCCA. Internal left primer: AATCGGGAATTGGACACAAC. Internal right primer: TCGCATTATATCGCAGCTTG. Internal WT amplicon: 2308 bp. Deletion size: 1026 bp. Deletion left flank: ACTTCACAAATCAGTGGTTTCGGACTCCTA. Deletion right flank: AAAAGAAAACTCTAGAAGCTTCATAAATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1638 ZK1025.4(ok2101) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans ZK1025.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2101 homozygotes (sterile, lays unfertilized eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTGCTGTTCGGGAAAAAT. External right primer: CAACTTTCCGGCTTGTAGGA. Internal left primer: TTTCCGGGTGAGTGAGTTTC. Internal right primer: GCGTCCGTGAAATTTGAGAT. Internal WT amplicon: 3284 bp. Deletion size: 1617 bp. Deletion left flank: TAAGCTTGGCGTCAGAGGCGAGCGTTAGCT. Deletion right flank: TTTCCGCCAGATCGGCAAATTTGCCGGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807