Variation Information: e937

Namee937 View on WormBase
Species C. elegans
Genetic positionI:1.02 +/- 0.000 cM
Genomic positionI: 6345831..6349156
Protein changeK04F10.4a K04F10.4b K04F10.4c K04F10.4d K04F10.4e K04F10.4g K04F10.4h K04F10.4i K04F10.4j Deletion

Strains carrying this variation

Strain Genotype Species Description
OH7115 lsy-22(ot244) otIs114 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. Heterozygotes are Rollers and GFP+. Homozygous lsy-22(ot244) otIs114 animals are Rollers and have a maternal effect embryonic lethal phenotype.
OH7410 unc-37(ot37) otIs114 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans otIs114 [lim-6p::GFP + rol-6(su1006)]. Rollers.
PD8753 dcr-1(ok247) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans dcr-1 homozygotes are completely sterile. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Segregates WT glowing hets, non-glowing steriles , very rare homozygous hT2 glowing animals, and dead eggs. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
PD9927 ced-9(n2812) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); nIs106 X. C. elegans nIs106 [lin-11::GFP + lin-15(+)] X. Homozygous maternal effect lethal ced-9 mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ced-9 homozygotes (maternal effect lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
PS3976 lin-17(en671) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); lin-18(e620) X. C. elegans Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile en671 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
PS5527 pop-1(q645) I/hT2 [bli-4(e937) let-?(h661)]; syIs187. C. elegans syIs187 [unc-119(+) + POPTOP]. Heterozygotes are WT and segregate WT and dead eggs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
RA440 swsn-2.2(tm3395) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type that segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm3309 homozygotes. tm3395 homozygotes are maternal effect lethal (late embryo & larval lethal) and have progeny with gonadogenesis defects. Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.
RA459 ham-3(tm3309) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type that segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm3309 homozygotes. tm3309 homozygotes are maternal effect lethal (late embryo & larval lethal) and have gonadogenesis defects. Previously known as swsn-2.1(tm3309). Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.
RA521 let-526(tm4795) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type and segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm4795 homozygotes. tm4795 homozygotes arrest as early larvae. Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.
RAF3 gld-1(q485) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); fem-1(hc17) IV. C. elegans Maintain at 15C. Pick fertile GFP+ hermaphrodites to maintain. Segregates WT GFP+ heterozygotes, non-glowing sterile gld-1 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. fem-1 is temperature sensitive; causes feminization. gld-1 homozygotes form germline tumors. Reference: Biedermann et al., Dev Cell 17, 355-364 (2009).
RB1175 F55F8.3(ok1115) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F55F8.3 Heterozygotes are WT and GFP+. Segregates very rare homozygous hT2 glowing animals. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: TACCAGTCAGAGTTGCCACG. Outer Right Sequence: GAATTGCGCCAATGAAGATT. Inner Left Sequence: TCAATTGCATTCCGTGATGT. Inner Right Sequence: GCGGAATTCGTGCTTTGTAT. Inner Primer PCR Length: 3397. Estimated Deletion Size: about 1300 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1189 chs-1(ok1120) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T25G3.2 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Segregates very rare homozygous hT2 glowing animals. Outer Left Sequence: tgtggctgtgttgcaaagat. Outer Right Sequence: tggagaagcattccgagagt. Inner Left Sequence: atttgcacttcagctggctt. Inner Right Sequence: ggttcatcggtttcctcgta. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1600 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1224 C34G6.2(ok1227) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C34G6.2 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: agatgggatgatggagcaag. Outer Right Sequence: caagaggtccggatcaaaag. Inner Left Sequence: gctgaggttgcttaggttgc. Inner Right Sequence: atctccgaaatcgtcacgtc. Inner Primer PCR Length: 3245. Estimated Deletion Size: about 2250 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1229 cyc-1(ok1258) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C54G4.8 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: ccgaagaattccgaatcaaa. Outer Right Sequence: tatcggcgcaagctactttt. Inner Left Sequence: tttggcgtcgaagaataacc. Inner Right Sequence: atgctgaggatcggattttg. Inner Primer PCR Length: 2598. Estimated Deletion Size: about 1600 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1230 F49D11.9(ok1190) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F49D11.9 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: aattgccaactgccgattat. Outer Right Sequence: tcggggagtacacaggctac. Inner Left Sequence: aagaacttcagagttgccgc. Inner Right Sequence: cgagctccataaaatcgcat. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 900 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1234 clk-1(ok1247) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans ZC395.2 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. ok1247 animals are homozygous viable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: CGGGTTTCGCACTATTTTGT. Outer Right Sequence: CAGCTACCGTACCCGACATT. Inner Left Sequence: GCTGGCCCAGTACATTTGTT. Inner Right Sequence: CAGTGTTCCGGATTTCAGGT. Inner Primer PCR Length: . Estimated Deletion Size: about 1250 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1236 Y110A7A.12(ok1054) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y110A7A.12 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. ok1054 animals are homozygous viable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: GAAACACACAGGAACGGGAT. Outer Right Sequence: AATCGGCGTTTTTCAGAATG. Inner Left Sequence: TGGCAGAAGATGATCCAGTG. Inner Right Sequence: GCGTGGATCTCGATTACGAT. Inner Primer PCR Length: 2442. Estimated Deletion Size: about 1300 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1260 csn-2(ok1288) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans B0025.2 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. ok1288 is homozygous viable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: ttttatcgattttcccaccg. Outer Right Sequence: cctcgcccatttactggtta. Inner Left Sequence: agacccaggaaaagttcggt. Inner Right Sequence: accatcatccaaaattgcgt. Inner Primer PCR Length: 3177. Estimated Deletion Size: about 1800 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1278 let-502(ok1283) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C10H11.9 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: tcaatgaagcgtcgaagttg. Outer Right Sequence: gatcgagataatgcgggaga. Inner Left Sequence: cgagttcacgagagagaccc. Inner Right Sequence: gccgaagacatttaacggaa. Inner Primer PCR Length: 3323. Estimated Deletion Size: about 1800 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1333 hrpr-1(ok1278) I/ ? hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) ?. C. elegans F58D5.1 Heterozygous. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP ok1278 homozygotes (larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: (04/2019) RB1333 was originally described as a homozygous strain carrying an unknown GFP transgene in the background. It was recently reported by a user that the strain is heterozygous for ok1278. Their characterization of the strain found that the deletion is balanced by a GFP-marked balancer, most likely hT2[qIs48], though the identity of the balancer has not been molecularly confirmed. Outer Left Sequence: tccaaatcctgaaaatccca. Outer Right Sequence: cagatcccagttttgcgaat. Inner Left Sequence: ttgtgtgtgcgtccaatttt. Inner Right Sequence: acattccaacggacgtcttc. Inner Primer PCR Length: 3310. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3068 C25A1.16(ve568[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous Lvl. Deletion of 477 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve568 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: TTTCACCCCCAATAAACCTATCAATTATCA ; Right flanking sequence: tcaggtttaaattagatttcttcgaatttg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3085 mrpl-34(ve585[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. C. elegans umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve585 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: ttatcaaactctcatttttagATGCCATCG ; Right flanking sequence: GTCGGCGACGGAATATATTCTTCAAAATCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
SS749 deps-1(bn121) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Maintain by picking GFP+ worms. deps-1 mutants are temperature-sensitive maternal-effect sterile (>80% sterile at 24.5C). Grow these balanced worms at 25C to verify that GFP+ worms are fertile and GFP- worms (deps-1 M+Z-) produce sterile progeny (M-Z-). It is best to keep deps-1 balanced because deps-1 M-Z- animals tend to lay many dead eggs and fewer eggs than WT at lower temps (15-20C).
SSM352 rpa-2(ok1627) rpa-4(iow24) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Homozygous sterile double mutant balanced by bli-4- and GFP-marked translocation. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP heterozygotes, arrested hT2 aneuploids, and non-GFP ok1627 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. rpa-4(iow24) deletion generated by CRISPR/Cas9 in the rpa-2(ok1627) mutant background. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.
SSM410 rpa-2(ok1627) rpa-4(iow59[3xFLAG::rpa-4])I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans N-terminal 3xFLAG tag inserted into the endogenous rpa-4 locus using Crispr/Cas9. Homozygous sterile deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP heterozygotes, arrested hT2 aneuploids, and non-GFP ok1627 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. Generated in rpa-2(ok1627) background. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.
TG1890 mus-81(tm1937) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); xpf-1(tm2842) II. C. elegans Segregates WT GFP+ heterozygotes, non-GFP mus-81; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of mus-81; xpf-1 double homozygotes are viable. unc-119(ed3) has likely been lost through outcrossing, but could still be present in the background. Reference: Agostinho A, et al. PLos Genetics 2013.
TG1891 slx-1(tm2644) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); xpf-1(tm2842) II. C. elegans Segregates WT GFP+ heterozygotes, non-GFP slx-1; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of slx-1 xpf-1 double homozygotes are viable. Reference: Agostinho A, et al. PLos Genetics 2013.
TG2452 mus-81(tm1937) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); xpf-1(tm2842) II; gtIs2512. C. elegans gtIs2512 [pie-1p::his-11::GFP + unc-119(+)]. Segregates WT GFP+ heterozygotes, non-GFP mus-81; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of mus-81; xpf-1 double homozygotes are viable. unc-119(ed3) has likely been lost through outcrossing, but could still be present in the background. Reference: Agostinho A, et al. PLos Genetics 2013.
TG2454 slx-1(tm2644) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); xpf-1(tm2842) II; gtIs2512. C. elegans gtIs2512 [pie-1p::his-11::GFP + unc-119(+)]. Segregates WT GFP+ heterozygotes, non-GFP slx-1; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of slx-1; xpf-1 double homozygotes are viable. unc-119(ed3) has likely been lost through outcrossing, but could still be present in the background. Reference: Agostinho A, et al. PLos Genetics 2013.
TH322 unc-13(e51) rsa-1(dd10) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Maternal effect lethal (Mel) allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schlaitz et al., (2007) Cell 128:115-27.
TH323 unc-13(e51) rsa-1(dd13) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Maternal effect lethal (Mel) allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schlaitz et al., (2007) Cell 128:115-27.
TY4986 htp-3(y428) ccIs4251 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I,III). C. elegans ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, htp-3(y428) ccIs4251 homozygotes that are GFP+ in body wall muscle but not pharynx, hT2 GFP+ homozygotes, and aneuploid dead embryos. Avoid picking viable aneuploids that often appear larger and longer than wild-type.
TY5038 htp-3(tm3655) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I,III). C. elegans Segregates WT GFP+ heterozygotes, GFP- tm3655 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Avoid picking viable aneuploids that often appear larger and longer than wild-type.
UP749 ksr-2(dx27) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Segregates WT glowing hets, non-glowing steriles (germ cells in oogenesis arrested in pachytene), very rare homozygous hT2 glowing animals, and dead eggs. Vulval development in ksr-2 animals appears normal. The molecular lesion of dx27 is a 285 base deletion. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
UP994 sur-6(sv30) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans sur-6(sv30) homozygotes are viable but segregate 100% dead embryos, and are GFP-. Weak Vulvaless and Unc. Maintain strain by picking GFP+ heterozygotes. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
VB1174 asna-1(sv42) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Homozygous lethal mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sv42 homozygotes (scrawny, arrests late larva or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1006 cbp-1(ok1491) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans R10E11.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, Bli non-GFP (hT2 homozygotes), and non-GFP ok1491 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1021 K07A12.2(ok1506) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans K07A12.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1506 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1034 cir-1(ok1488) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F55F8.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1488 homozygotes (thin, late larval or early adult arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1045 bet-1(gk425) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y119C1B.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk425 homozygotes (sterile with spiky vulva). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1050 wdr-12(ok1478) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F55F8.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1478 homozygotes (Dpy, early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1085 dnj-21(ok1577) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T19B4.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1577 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1094 rtcb-1(gk451) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F16A11.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk451 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. May also segregate Bli non-GFP (hT2 homozygotes), which are the result of rare recombination. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCCCTTCTTCATCAATTCC. External right primer: ATAATTTCTCGGACCCGCTT. Internal left primer: GCGTAATGATTTCCTGCTCC. Internal right primer: CATCATCTTTCCACCACACG. Internal WT amplicon: 1913 bp. Deletion size: 370 bp. Deletion left flank: ATGATTCACTAACCGAATGTCCAACAATTC. Deletion right flank: ATCTCAAAATCTTTAGTCAAGAAAACATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1096 kin-3(ok1516) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans B0205.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1516 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1138 drsh-1(ok369) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F26E4.10. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok369 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGTCTCGAAGTTCTTGCCT. External right primer: AAACGAAGAACGAGCTGGAA. Internal left primer: TCAGGAACCATCGTGTGAAA. Internal right primer: CTTGCATGCCATCATATTCG. Internal WT amplicon: 2395 bp. Deletion size: 1742 bp. Deletion left flank: CTAGATTAGCCAAAGCCAGCTCAGCCACCC. Deletion right flank: TATCGTTGAATTTATATTCGATGACTTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1139 mom-4(gk563) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F52F12.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk563 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTGAACTTGGCTGTTGGA. External right primer: CGCAGATGTATGGTTTGGTG. Internal left primer: TTGAAACATCCATGAAGCCA. Internal right primer: CACTGATGAACAGCAAACGG. Internal WT amplicon: 2042 bp. Deletion size: 632 bp. Deletion left flank: AAGAATATTTGATTGCTGCTGGCCTGAAAA. Deletion right flank: AGACCAACGGGACACAGACAGATTTCCGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1156 F30A10.6(ok1602) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F30A10.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1602 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTAATGGCTCCTTGCTCAGG. External right primer: CCGAACCGCAAGTTGTTTAT. Internal left primer: GTCACAGCTAATGGGAGCGT. Internal right primer: AACTCAACAGGATCCCTCCA. Internal WT amplicon: 3044 bp. Deletion size: 745 bp. Deletion left flank: CTTGTAAATCAAAAAGGAAGAGAGAAAAAA. Deletion right flank: CTACGGAAAACACTTTTTTACTACCTTATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1157 C30C11.4(gk533) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C30C11.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk533 homozygotes (sickly sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1160 egl-30&emr-1(ok252) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans M01D7.7, M01D7.6. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok252 homozygotes (phenotype uncharacterized). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1161 M04F3.1(ok1627) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans M04F3.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1627 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGGAAGAATTTGGAGGATGA. External right primer: GGCTACGAGCAGTTCCTGAC. Internal left primer: GCGTATTGTAAGGCACGGTT. Internal right primer: AATGTGATTTGCCGTTCCTC. Internal WT amplicon: 2153 bp. Deletion size: 917 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807