| RG3079 |
bmy-1(ve579[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mIn1[dpy-10(e128) umnIs43] II. |
C. elegans |
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Mel. Deletion of 694 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 that give dead progeny (ve579 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ataatgtttcgcaatgctctcctttcctac ; Right flanking sequence: GAAGGACAGAGCTTTGACGGACCTGCGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3080 |
cchl-1(ve580[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mIn1[dpy-10(e128) umnIs43] II. |
C. elegans |
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 1136 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve580 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ttattaggcttatggagcggtgggtaaatt ; Right flanking sequence: cacggaaatgatgaaactagagaaaaaagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3083 |
copz-1(ve583[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II. |
C. elegans |
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Emb. Deletion of 898 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead eggs (ve579 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atcggctcgtaaatctacacgaaaacctag ; Right flanking sequence: CACAAATCGGCTTCTCGTTCATGAAATCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3090 |
dhps-1(ve590[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. |
C. elegans |
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Ste. Deletion of 4636 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+, Sterile GFP+ non-mKate2 (ve566 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tttttcagaaacttgctccaaaATGAGCAC ; Right flanking sequence: agGAGTCGTAAAACACCACATCAACAACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3094 |
+/mT1[umnIs52] II; F10E9.5(ve594[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate2 larvae (ve594 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AGCAACATACAGATGCATCACGTCAAGgta ; Right flanking sequence: CTCTGGCCTAATATTCCATTCAGATTTTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3103 |
+/mT1[umnIs52] II; aco-2(ve603[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 3465 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve603 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaataggttctatttctttccctttgtcgg ; Right flanking sequence: tgagattgtttttatgtatgagtagatatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3106 |
rpa-1(ve606[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. |
C. elegans |
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 2554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve606 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttctacgccattttttttggcgcgtatccg ; Right flanking sequence: atccacaatcgctgattttgtacaatgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3116 |
+/mT1[umnIs52] II; rpl-23(ve616[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 483 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve616 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaacaacagcTTAAGCGATGGATCCAGCG ; Right flanking sequence: CGTCCTCTCTTCGACATtttacctgaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3117 |
+/mT1[umnIs52] II; dars-1(ve617[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous early larval arrest. Deletion of 1747 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve617 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ATGGTAACTCGCTCAAGTCCGATGCCTCCT ; Right flanking sequence: TGGAGAGTTTTGGTTGTTCACCTTCGGCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3119 |
+/mT1[umnIs52] II; cpf-2(ve619[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous early larval arrest. Deletion of 1981 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve619 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TTTCTCTTCAACTGCTGTCTCAGCTCTATT ; Right flanking sequence: tagctccacccacattttttgtgacgtcac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3125 |
+/mT1[umnIs52] II; prx-19(ve625[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile. Deletion of 1698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 most are sterile adults, but escapers do lay small broods (ve625 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tggaaaataactgaggacacttattgctac ; Right flanking sequence: tttggatcgataaaacacacaatcggtgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3126 |
ints-11(ve626[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II. |
C. elegans |
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous arrested larvae. Deletion of 2171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve626 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. |
| RG3128 |
+/mT1[umnIs52] II; vha-14(ve628[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 1453 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve628 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atgtttttttcatagaaataacaaactttt ; Right flanking sequence: caccctccgatgttcttcctgttttctatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3135 |
+/mT1[umnIs52] II; F54C8.1(ve635[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve635 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AGCAAAGTGTGCCATGCAAAACATCAGAAA ; Right flanking sequence: GTAGATAAGCTGGTTGCCGAGGGAAAACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3136 |
+/mT1[umnIs52] II; F54C8.4(ve636[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 1778 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve636 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaagatcaaaagttgaacagggagaacat ; Right flanking sequence: gggacttgaattttcggagaaagaagacgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3141 |
+/mT1[umnIs52] II; popl-5(ve641[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 2064 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve641 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: caatgcgcctacatgcctacctacatgcca ; Right flanking sequence: AGGCTCATTTTCAAAATAGAATATCCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3142 |
gtf-2E2(ve642[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1[dpy-10(e128) unc-52(e444) umnIs37] II. |
C. elegans |
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval lethal. Deletion of 1631 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve642 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaaaaataacttgaaacttcaaaagaaata ; Right flanking sequence: TTCGCTTTTGCTGCTTCTGAAGAGTATGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3144 |
+/mT1[umnIs52] II; T20B12.3(ve644[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 1668 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve644 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tacgcaaacatgacacctgacgacatttca ; Right flanking sequence: GTGGGAAATTCGCTCCAAAACACGAAGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3146 |
T13H5.4(ve646[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1 [dpy-10(e128) umnIs43] II. |
C. elegans |
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 1702 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve646 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ACAGAAGTCCTTGTCTTTTCAAATCCTCAT ; Right flanking sequence: CCTCGTGCAAGTTTCTGATGGTTTCTAGAC. sgRNA #1: GGTCACCAGGAAGATGTATG; sgRNA #2: CAGAAACTTGCACGAGGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3147 |
T14B4.3(ve647[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. |
C. elegans |
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous sterile. Deletion of 1115 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve647 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaccaatgctgatgaaatcaacttccacgg ; Right flanking sequence: GATGGGTAGACAGAAGAAAGATTAGaatta. sgRNA #1: caagagaacttgaaactccg; sgRNA #2: GATCCTGGTTCGACTATCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3148 |
+/mT1[umnIs52] II; T20B12.7(ve648[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile, slight Dpy. Deletion of 1939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 slight Dpy sterile adults (ve648 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: acggttaattgaaaatgctccgcccccgaa ; Right flanking sequence: GTTGGGATGCTTCAAAAAGTCGGACAAAAT. sgRNA #1: cctaacgagagccatggttc; sgRNA #2: GTCCGTCACTTGAAGCAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3154 |
T26C5.5(ve654[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. |
C. elegans |
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygotes are unhealthy, lay small broods. Deletion of 696 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 unhealthy animals (ve654 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcactacattgcctcCTAACATGTCCTTCC ; Right flanking sequence: gggggtttcctctttctttctttttaaaga. sgRNA #1: ATACATATTATTGGATTGGA; sgRNA #2: attgaaatggagaaggacgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3155 |
vps-2(ve655[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. |
C. elegans |
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval lethal. Deletion of 850 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve655 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CTCTTCTAAGCTGATCAAGACGGGCCTGAA ; Right flanking sequence: AGGAAATCCATctgaaaagtggaatatttc. sgRNA #1: TGATGTTGACGATGATCTTC; sgRNA #2: tttcagATGGATTTCCTGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3158 |
+/mT1 [umnIs52] II; dhhc-8(ve658[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygotes are egg-laying defective, unhealthy. Deletion of 9372 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 Egl-d adults (ve658 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tgataatttaataaaacctctattccagtc ; Right flanking sequence: CGGACACCTTCCAGGACGGCGACGTCTCCA. sgRNA #1: tctgcatcagaccgaaattc; sgRNA #2: TAAATTCGAAATCCGGGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3164 |
+/mT1 [umnIs52] II; Y39A1A.22(ve664[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygotes are slow growing, Mel. Deletion of 2999 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adults that lay dead eggs (ve664 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaacctcccgaTTAGGTGTTAGTAGTGTCG ; Right flanking sequence: ggggaacactcattgatttaaatcatgatt. sgRNA #1: ATGAAAGTAGTAGTGACGAC; sgRNA #2: gcaaaaaaacacaatctcga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3170 |
+/mT1 [umnIs52] II; uev-2(ve670[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile. Deletion of 1228 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve670 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aagatccagcttaggttcagttaacgcggc ; Right flanking sequence: tatggaatttttcagatttttctccaaaaa. sgRNA #4: GGATACTTCCATGTATCCCA; sgRNA #5: AACGTCGAATAATAGCGCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3171 |
+/mT1 [umnIs52] II; mlc-5(ve671[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile, Dpy. Deletion of 866 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile Dpy adults (ve671 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaggctgaatttttgcttgagaatttctg ; Right flanking sequence: ctcggcattttccacacaatctatttattt. sgRNA #1: tttgcttgagaatttctgga; sgRNA #2: atcatttccattaatttcct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3174 |
+/mT1 [umnIs52] II; Y43F4B.5(ve674[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 3288 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve674 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atagagaaacggcaaggtcatttacctggc ; Right flanking sequence: TCTGGAAAGTGTGATTTCTGAGATGGATCA. sgRNA #1: tgtgtggatgagaaaaggcc; sgRNA #2: GGGAAAAACGCAGAATGATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3177 |
T21B10.3(ve677[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. |
C. elegans |
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous maternal effect lethal. Deletion of 4525 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adult animals that lay dead eggs (ve677 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gctcgtaacagcaaaATGAATAATCCAGAA ; Right flanking sequence: attgaattcgtatttttttccattccacat. sgRNA #1: TCTGTTACAGCGCTTTCTTC; sgRNA #2: aaaaatacgaattcaatggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3178 |
+/mT1 [umnIs52] II; Y39A1A.14(ve678[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest w/ a few escapers. Deletion of 1011 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve678 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aattaatttctccgaatttcagATGTCCCA ; Right flanking sequence: GGGGAATTATTTAAttgattttttgcagtt. sgRNA #1: GTGCAACTGTATCGTACTCG; sgRNA #2: CAGTGGACTTGAGGAGATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3180 |
eif-3.B(ve680[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 2917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve680 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: gcgcttgcaacgacgctccgttctcccgca ; Right flanking sequence: tctccgtgttttctggtggtttttgccgat. sgRNA #1: actctaaacaacacccatgc; sgRNA #2: accagaaaacacggagagac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3181 |
+/mT1 [umnIs52] II; grwd-1(ve681[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
Y54H5A.1. umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 1630 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve681 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: GTCCGGTGAAAATGACGTTGAAATGCATGA ; Right flanking sequence: TATGGGTCAGAATGAGGTCAAAGAAGTTCA. sgRNA #1: TGACGTTGAAATGCATGATG; sgRNA #2: ACAGCTGATGTTCGTCCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3190 |
+/mT1 [umnIs52] II; Y54H5A.2(ve690[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile. Deletion of 12039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve690 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: cacttgcagtttccgcttgatcacccaaat ; Right flanking sequence: cccgggtacgcgtccttctcaccgacaaac. sgRNA #1: ccgcttgatcacccaaatta; sgRNA #2: gtatacctcattcgcccacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3198 |
+/mT1 [umnIs52] II; ZK686.3(ve698[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 1309 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve698 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tctttggagaaggggaaaacaccttctagt ; Right flanking sequence: GACGGCGAGCAGCATgaagaacagtaatac. sgRNA #1: gggaaaacaccttctagttt; sgRNA #2: CTGCTGAGCCGACTCGTAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3217 |
Y48B6A.1(ve717[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. |
C. elegans |
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 3274 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve717 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ataataacaaaagaaaacgaaggtgtaaca ; Right flanking sequence: cccaacatttttccgatttcaatttctctt. sgRNA #1: aataaaaacaaagaacaacg; sgRNA #2: cctaaaatcgcgacgcacta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3224 |
+/mT1 [umnIs52] II; sftb-1(ve724[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 5479 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve724 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: gggattaaaatataaaaggtttcgttttct ; Right flanking sequence: atattcaaagaaatacactcaagaaactaa. sgRNA #1: atgaaaatgtgatgaaagga; sgRNA #2: tgttcattgtaaaaggatta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG5002 |
+/mT1 [umnIs52] II; psd-1(gk5580[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5580 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4509 and CGC66. gk5580 is a 6731 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TACAAGCTCGACACTTGCCACGTGGACTAA. Right flanking sequence: TCTGGCGGACCGAAGAACGTTGAAAAGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG93 |
lin-29(ve5) rol-1(e91)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, Egls which have a protruding vulva, and DpyUncs. Maintain by picking WT. lin-29 suppresses rol-1 phenotype (rol-1 is an adult specific Roller and lin-29 animals never molt to adult cuticle). |
| SA25 |
daz-1(tj3)/mIn1 [dpy-10(e128) mIs14] II. |
C. elegans |
Heterozygotes are WT (GFP+) and segregate WT (GFP+), Dpys (GFP+) and Steriles. |
| SA29 |
kel-1(pe201)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, DpyUnc and L2 larva. kel-1(pe201) homozygotes arrest development at early L2. pe201 deletes a 3.6 kb region including most of the kel-1 ORFs. |
| SA4 |
cdl-1(w37)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, dead eggs (homozygous cdl-1(w37)), and DpyUnc. w37 carries a 4.7kb deletion that removed the entire cdl-1 ORF and part of the neighboring ORF (T19E10.1), with a small insetion of about 60 bp. |
| SL740 |
dpy-2(e8) unc-4(e120)/mIn1 [dpy-10(e128) mIs14] II. |
C. elegans |
Heterozygotes are WT with major GFP signal in pharynx. Segregates Dpy GFP+ mIn1 homozygotes and GFP- DpyUncs. |
| SL940 |
wee-1.3(q89eb94) unc-4(e120)/mIn1 [dpy-10(e128) mIs14] II. |
C. elegans |
Heterozygotes are WT with major GFP signal in pharynx. Segregates Dpy GFP+ mIn1 homozygotes and GFP- Uncs which are viable but lay oocytes (lay viable embryos if mated to WT males). Strain has a Him phenotype. 3.4% males. Mutant males have abnormal sperm. Class 1 suppressor. |
| SL978 |
wee-1.3(q89eb60) unc-4(e120)/mIn1 [dpy-10(e128) mIs14] II. |
C. elegans |
Heterozygotes are WT with major GFP signal in pharynx. Segregates Dpy GFP+ mIn1 homozygotes and GFP- Uncs which are viable but lay inviable embryos (lay viable embyros if mated to WT males). Strain has a Him phenotype. 0.4% males. Mutant males are fertile. Class 2 suppressor. |
| SP127 |
unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Hets are WT and segregate WT, Unc-4 and paralysed DpyUnc (mnC1). Maintain by picking WT. |
| SP140 |
him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/unc-4(e120) let-28(mn28) II. |
C. elegans |
Hets are WT and segregate WT, dead eggs, paralyzed DpyUnc and males. Maintain by picking WT. |
| SP142 |
him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/let-30(mn30) unc-4(e120) II. |
C. elegans |
Maintain strain by picking WT hermaphrodites. Segregates WT, dead eggs, paralysed DpyUnc and males. |
| SP143 |
him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/let-31(mn31) unc-4(e120) II. |
C. elegans |
Hets are WT and segregate WT, paralysed DpyUnc, L1 Lethal Unc-4s and males. Maintain by picking WT. |
| SP144 |
him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/unc-4(e120) let-32(mn32) II. |
C. elegans |
Hets are WT and segregate WT, dead eggs, paralysed DpyUnc and males. Maintain by picking WT. |
| SP152 |
him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/zyg-11(mn40) unc-4(e120) II. |
C. elegans |
Hets are WT and segregate WT, paralysed DpyUnc, Sterile Unc-4, and males. Maintain by picking WT. |