| MT20110 |
unc-4(e120) rol-1(e91)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II. |
C. elegans |
nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Rol; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal. |
| MT20111 |
unc-4(e120) bli-1(e769)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II. |
C. elegans |
nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Bli; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal. |
| MT3316 |
lin-4(e912)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
|
| MT4106 |
clr-1(e1745) dpy-10(e128) II. |
C. elegans |
Maintain at 15C. |
| MT4156 |
lin-26(n156)/mnC1 [dpy-10(e128) unc-52(e444)] II; him-5(e1490) V. |
C. elegans |
Heterozygotes are WT and segregate WT, Egls with abnormal tails and DpyUncs. |
| MT5103 |
lin-31(n301) dpy-10(e128) II. |
C. elegans |
Dpy. Variable Muv. |
| MT5104 |
lin-31(n301) clr-1(e1745) dpy-10(e128) II. |
C. elegans |
Dpy. Muv. Starved translucent appearance at 20c; inviable at 25C. |
| MT555 |
lin-8(n111) dpy-10(e128) II. |
C. elegans |
Dpy. |
| MT5823 |
lin-26(n156) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II; him-5(e1490) V. |
C. elegans |
Heterozygotes are WT. |
| MT7480 |
sqv-8(n2825)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, DpyUncs and Sqvs which have and abnormal vulva from mid-L4 and are somewhat sterile. |
| MT7483 |
sqv-8(n2822)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, DpyUncs and Sqvs which have and abnormal vulva from mid-L4 and are sterile. |
| MT8191 |
snt-1(md290) unc-104(e1265) II/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, Unc, and paralyzed Dpy Uncs. Reference: Jorgensen EM, Nature. 1995 Nov 9;378(6553):196-9. |
| MT9088 |
sqv-7(n2844) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, UncSqv and DpyUncs. n2844: mid-L4 vulva abnormal, sterile. |
| MT9940 |
dpl-1(n3316) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. n3316 is Mel. 1422 bp deletion removes cosmid T23G7 nt 5200-6621. |
| NB131 |
wrn-1(gk99)/mIn1[dpy-10(e128) mIs14(GFP)] II; exo-1(tm1842) III. |
C. elegans |
Heterozygotes (wrn-1/mIn1;exo-1) are WT and GFP+. mIn1 homozygotes (mIn1;exo-1) are Dpy and GFP+. wrn-1;exo-1 homozygotes are non-GFP. Reference: Ryu, J.S. and Koo, H.S. (2017). FEBS Lett. |
| NB320 |
dna-2(jh115)/mIn1[dpy-10(e128) mIs14(GFP)] II. |
C. elegans |
Heterozygotes are WT and GFP+. mIn1 homozygotes are Dpy and GFP+. dna-2 homozygotes are non-GFP. Reference: Lee, K.H., Lee, M.H., Lee, T.H., Han, J.W., Park, Y.J., Ahnn, J., Seo, Y.S. and Koo, H.S. (2003). Mol Cell 15, 81-6. |
| NG2295 |
hlh-14(gm34)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, DpyUncs, and arrested larvae (hlh-14 homozygotes). |
| NG3124 |
dsh-2(or302)/mIn1 [mIs14 dpy-10(e128)] II. |
C. elegans |
mIs14 [myo-2p::GFP + pes-10p::GFP]. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ heterozygotes, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP or302 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. or302 homozygotes are GFP- and are Emb, ABar and have EMS spindle misalignment. or302 is a deletion starting at 503 and ending at 1578 of C27A2.6. |
| NJ549 |
dpy-10(e128) unc-104(rh142)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Severe unc-104 allele, hypercontracted coiler. Dpy heterozygotes segregate Dpy, mnC1 dpy-10 unc-52 homozygotes (paralyzed Dpy), and very small and sick dpy-10 unc-104 homozygotes. |
| NL344 |
gpb-1(pk44)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT (heterozygotes), L1 arrested animals (pk44 homozygotes), and paralyzed Dpy Uncs (mnC1 homozygotes). |
| OK245 |
pyr-1(cu8) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, Dpy Steriles (mnC1 homozygotes), and Unc-4 animals which have a partially penetrant Mel phenotype. |
| OT125 |
mua-9(rh197)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregates WT, DpyUncs and Mua. rh197 animals are inviable as homozygotes. |
| PD7217 |
let-852(cc504) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals. |
| PD7218 |
let-853(cc505) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals. |
| PD7220 |
let-854(cc507) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, paralyzed Dpys and dead eggs. cc507 is a recessive embryonic lethal. |
| PD7222 |
let-855(cc509) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals. |
| PD7227 |
let-856(cc514) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals. |
| PD7229 |
let-857(cc516) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, paralyzed Dpys and embyronic lethals. |
| PD7244 |
let-856(cc529) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals. |
| PD8662 |
lin-31(n301) hlh-1(cc450)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, DpyUnc (mnC1 homozygotes) and larval lethals (lin-31 hlh-1 homozygotes). The lin-31 hlh-1 homozygotes are very Dpy and Lumpy and look like they hatched just after reaching the two-fold stage. See also WBPaper00001975. |
| PJ801 |
jDf1/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are Unc (Paralyzed adult) and segregate more Uncs, DpyUncs and dead eggs. Growth slow. Pick Unc to maintain. Crossover suppressed. |
| PJ803 |
jDf2/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are Unc (Paralyzed adult) and segregate more Unc, DpyUnc and dead eggs. Pick Unc to maintain. Balanced well. |
| PK172 |
ptc-1(ok122) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, paralyzed Dpys, and Uncs which are sterile (with 1-2 escaper progeny). ptc-1 homozygotes have multinucleate germ cells (both sperm and oocytes). ptc-1 homozygotes have an underproliferated germline. |
| PS1410 |
let-23(sy15) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1423 |
let-23(sy17) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Reference null allele for let-23. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS1524 |
let-23(sa62) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
10% of heterozygotes are Muv, 90% are WT. Segregates UncMuv and DpyUncs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS295 |
let-23(sy97) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozgyotes are WT and segregate WT, DpyUncs and Vulvaless Unc-4s. sy97 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS302 |
let-23(sy10) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. sy10 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS3411 |
cog-1(sy607)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are WT and segregate WT, DpyUncs and Pvul Sterile cog-1 homozygotes. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4064 |
let-23(sy621sa62) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. |
C. elegans |
Heterozygotes are approx. wild-type in size and Muv. Pick Muv non-Unc (heterozygotes) to maintain. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS4886 |
plc-3(tm1340)/mIn1 [mIs14 dpy-10(e128)] II. |
C. elegans |
Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm1340 homozygotes (sterile). This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS5131 |
let-23(sy12)/mIn1 [mIs14 dpy-10(e128)] II. |
C. elegans |
Heterozygotes are GFP+. mIn1 homozygotes are Dpy and GFP+. let-23(sy12) homozygotes are non-GFP. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| PS79 |
dpy-10(e128) let-23(sy1) II. |
C. elegans |
Dumpy. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |
| RA491 |
swsn-7(tm4263)/mIn1 [mIs14 dpy-10(e128)] II. |
C. elegans |
Heterozygotes are wild-type GFP+ that segregate wild-type GFP+ heterozygotes, GFP- tm4263 homozygotes (MEL), and Dpy GFP+ mIn1 homozygotes. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852. |
| RG3042 |
+/mT1[umnIs52] II; cee-1(ve542[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Ste, Pvl. Deletion of 1124 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste Pvl GFP+ non-mKate2 (ve542 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: GTTTTATGATGCTCTTCAATTCTACCGGAC ; Right flanking sequence: GCTGGTGCACCGGCTCCAGCTCCAGTTCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3044 |
+/mT1[umnIs52] II; rpn-3(ve544[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous arrest at larval stage. Deletion of 1779 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (ve544 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: ttcaaattttaaagggaaATGGCTCCGAAA ; Right flanking sequence: ccgaatgaattttataaggatgaattgcat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3047 |
+/mT1[umnIs52] II; K12H4.5(ve547[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous lethal. Deletion of 418 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal GFP+ non-mKate2 (ve547 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: aaattaattaatttataatgtgatcctttt ; Right flanking sequence: agtcgtagacgattttcgattttcactgta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3061 |
+/mT1[umnIs52] II; algn-11(ve561[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Lvl. Deletion of 2578 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, arrested GFP+ non-mKate2 larvae (ve561 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: cgatcagtttgaaatccataggaaagtttc ; Right flanking sequence: GAATCCAGAATAAAGGCTGAATGGTATAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3066 |
snpc-1.1(ve566[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. |
C. elegans |
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Lvl. Deletion of 2013 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve566 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ animals. Left flanking Sequence: agattaataaaataacaaaagtcggagatg ; Right flanking sequence: gcgggaaccagcggtattcaacgcatttca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| RG3077 |
+/mT1[umnIs52] II; bcas-2(ve577[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. |
C. elegans |
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Ste, Pvl. Deletion of 944 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Pvul GFP+ non-mKate2 adults (ve577 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: aaatccaaaaTCAGTTCTCCTGATCCTCTT ; Right flanking sequence: GTAAGTGCTAACGGTTTGGAGCTCATcacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |