Transgene Information
| Name | syIs179 View on WormBase |
|---|---|
| Description | [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4promoter::YFP PCR fusion (1 ng/uL)(100:1)] |
| Reporter | YFP |
Strains carrying this transgene
| Strain | Genotype | Species | Description |
|---|---|---|---|
| PS4997 | unc-119(e2498) III; syIs179. | C. elegans | syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. |