Transgene Information

NameqIs48 View on WormBase
Description[Pmyo-2::gfp; Ppes-10::gfp; Pges-1::gfp]
ReporterGFP

Strains carrying this transgene

Strain Genotype Species Description
VC1245 smc-3(ok1703) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y47D3A.26. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1703 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1248 gmn-1&Y75B8A.18(ok1708) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y75B8A.17, Y75B8A.18. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1708 homozygotes (mostly sterile; occasional progeny arrest as larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TACTTCGTTTCGAGCGTCCT. External right primer: AGTAGGCCGTCAAATTGGTG. Internal left primer: TCCGCCGTCTCTTCTATTGT. Internal right primer: AACAATCCTGTTCCGCTCAT. Internal WT amplicon: 2898 bp. Deletion size: 1490 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1250 pcaf-1(ok1690) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y47G6A.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1690 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGAAATCCCTTCGCACACT. External right primer: ATTGGCATTTTTCTAGCCGA. Internal left primer: GCGAAAAACAACGATTAGCC. Internal right primer: CTGGAACTTGGAAACTTGGG. Internal WT amplicon: 3142 bp. Deletion size: 1258 bp. Deletion left flank: CTACAGGAAGAGGAGAGTGGGCTCATTGAG. Deletion right flank: TTTGCCCATTTTTGCTAAAATTGAACCAAA. Insertion Sequence: CCCATTTTTGCCCATTTTTGCCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1251 rae-1(ok1720) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F10G8.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1720 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATACATTCGAACGCGACACA. External right primer: CCAGAAACGCGGTTTAACAT. Internal left primer: GCGCTCTACTGCCAATTTTC. Internal right primer: GGAAAGCACCCGAACTATGA. Internal WT amplicon: 2465 bp. Deletion size: approximately 750 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1279 sep-1(ok1749) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans ok1749. Homozygous sterile deletion chromosome balanced by bli-4- let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1749 homozygotes (sterile Unc adult, often with mid-body constriction). Homozygous hT2[qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCGTTTTGTACGTCGATTT. External right primer: TCGGATCCTACTCGCTCATT. Internal left primer: AATCGCTCCCAACAGAATTG. Internal right primer: TTATTTCAGTTCCCGGATCG. Internal WT amplicon: 2960 bp. Deletion size: 1234 bp. Deletion left flank: TTTCTCAACTTTCGGACGACGTCCGAACGG. Deletion right flank: GGAAATTGATACGTTATTTTTAAGAATGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1280 kin-10(ok1751) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T01G9.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1751 homozygotes (grotty adult, dies). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTCGCAAAATTTCACGTTT. External right primer: TTCGACAGAAAACTGCTGGA. Internal left primer: GTGACGAAGACAGGCACAAA. Internal right primer: TTCACCCAACCTGTACCCAT. Internal WT amplicon: 2149 bp. Deletion size: 1452 bp. Deletion left flank: TCTTGAGTTTTGTCGGAAAAGAAAATTTTG. Deletion right flank: TTGAGACCTGTCAAATTGAACCGATCCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1308 eef-2(ok1774) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F25H5.4. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1774 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTGGCGCTCTACCGTACTTT. External right primer: AGGCCGAAACAAATTCAATG. Internal left primer: GCAAATTTTGGGCCTACTGA. Internal right primer: AAACGATCTGGTTTGGCTTG. Internal WT amplicon: 2855 bp. Deletion size: 1443 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1315 T10F2.4(gk575) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T10F2.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk575 homozygotes (sterile with no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACACGTCACCAATGAACGA. External right primer: CGTGGTGTCTCGAATTCCTT. Internal left primer: CATGTCGAAGGACAGGGAGT. Internal right primer: TTCGTTTATGTCCCACGTCA. Internal WT amplicon: 1565 bp. Deletion size: 632 bp. Deletion left flank: TGAATGTTTGCATAACCTGTTCCTTTTCAT. Deletion right flank: AGATAATTGCAAGGTTGACAAACCTGGTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1325 tbg-1&F58A4.9(ok1786) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F58A4.9, F58A4.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1786 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTCGTTGTTGCGGAATTTT. External right primer: CGCCGAGTTCAAAAAGAAAG. Internal left primer: CTTTCTTCGGAAATGCTTCG. Internal right primer: GCTCAATGTGTTCGCAGAAG. Internal WT amplicon: 2187 bp. Deletion size: 1269 bp. Deletion left flank: GGCTTGAGCAAGCTGATTTCCGCACTGTCC. Deletion right flank: GAGTAAGAAAAAGAAGATCAAAGTGGATAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1343 plk-1(ok1787) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C14B9.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1787 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTAGCACCCTTTTTCATCGG. External right primer: GCAGATCCCATTGGCATAAT. Internal left primer: AATCGACTTCCCAACATTGC. Internal right primer: TGGGACTAAAAGGGTCGATG. Internal WT amplicon: 2510 bp. Deletion size: 1798 bp. Deletion left flank: AAGGCGGTCACCGAACCTGAAGCTCGTTAT. Deletion right flank: GCCACGGTCAATGGCAGCTGCTCGTTCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1344 T09B4.9(ok1792) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T09B4.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1792 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTTTCAGGCATTATCCA. External right primer: TCAAAATTGCATCACTGGGA. Internal left primer: TCTTCGCTCCGAATTGAACT. Internal right primer: TTGTGGAAACGGGATACGAT. Internal WT amplicon: 2834 bp. Deletion size: 1635 bp. Deletion left flank: AAAAGTTGAGATTTAATTAGGACACTGAGA. Deletion right flank: TTCTCCAAATCGAACCCATCTGTCCGTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1346 F59B2(ok1801) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F59B2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1801 homozygotes (sterile, Dpyish). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGGCTCAGCAAGAAAATGAG. External right primer: GTGCTCGATGTCCACACAAC. Internal left primer: ATACCGCCTGCAATTTTCTG. Internal right primer: GCTTTTGAAATCGAAGCGAC. Internal WT amplicon: 2606 bp. Deletion size: 829 bp. Deletion left flank: TTAACAAGAAAAAATGATTTTAAAACCGTG. Deletion right flank: AAAAATTAACATGTCGAGAACCTAAGTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1350 imb-3(ok1795) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C53D5.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1795 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGGGGGAACAATGAGGACT. External right primer: AACCTCATCGACGATTCTGG. Internal left primer: GGGAGAAGTGGTGGAACAAA. Internal right primer: TGTTATCGCTTTCGCTGTTG. Internal WT amplicon: 3104 bp. Deletion size: 1411 bp. Deletion left flank: AGATTCTCGGAAGATTCTGATTTTCTGGTC. Deletion right flank: TTCATTCCGTCTCCGAGAAGGTTCAGGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1359 K02B12.3(ok1827) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans K02B12.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1827 homozygotes (probable embryonic/early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAATGGAGAAGGATGGACCC. External right primer: TGGAACAAGAACCGGAAAAC. Internal left primer: TGAGAAATAGTGAAGCGCGA. Internal right primer: CTATTTGAACACCCGCCAAT. Internal WT amplicon: 2550 bp. Deletion size: 1420 bp. Deletion left flank: AAAATTCGGATTTAATTATTTAGATAGAAG. Deletion right flank: CCACGTGTTCTCGTTGAAAATCGCTTTCGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1360 Y48G1C.7(ok1850) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y48G1C.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1850 homozygotes (sterile with no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGGGTCGACTATCACATCA. External right primer: CTCGCAGAGCTCACAAAGTG. Internal left primer: CACAACCACTTGTTCGAGGA. Internal right primer: CGCGTGTAGGATCCATTTTT. Internal WT amplicon: 3378 bp. Deletion size: 985 bp. Deletion left flank: AATTAGATAAAAATTGGATTTTCAGCACAT. Deletion right flank: TTTTTTACTTTCGGAACGTCCCACTTTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1391 cdc-25.1(ok1888) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans K06A5.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1888 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGGAGACCTGCAAAGTGT. External right primer: AAAAGTGGCTTGTTCATGGG. Internal left primer: GTGCTATTATTCGGCGTCGT. Internal right primer: TCAATCACGGTCCTTTTTCC. Internal WT amplicon: 2246 bp. Deletion size: 1512 bp. Deletion left flank: CCTGGAGCCCAAGTTGAACAATGCGCTCTT. Deletion right flank: ATCATAGTTGTAGCTGAAAATTGTTTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1393 hcp-3(ok1892) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F58A4.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1892 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCTTGCACGATGCTACCTG. External right primer: AAACAGAGCGATTAGCCGAA. Internal left primer: CGTGGTCAATTTCAGAGCAA. Internal right primer: ACTCGGTTAGCAGGCACACT. Internal WT amplicon: 2320 bp. Deletion size: 1169 bp. Deletion left flank: CTTGAAGAGCACTGATGGCGTCAGAACGAA. Deletion right flank: AAATATTCCATCAAAACTTCACGAAACTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1395 mdt-30(ok1791) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F44B9.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1791 homozygotes (late larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACAATGCGTTGGGTATCAG. External right primer: TCCCAGATGAAGCAATGTCA. Internal left primer: TCAGCCGCCAAGTTTTTAAC. Internal right primer: CAATGAATCCGAATCAACCC. Internal WT amplicon: 2678 bp. Deletion size: 1412 bp. Deletion left flank: CTTGATTCAATGGCTTCCGTTCCATTACTT. Deletion right flank: GAGTAAAAAAGTAAAATTTCGTGTTTGGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1400 cdk-1(ok1882) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T05G5.3. Homozygous sterile deletion chromosome balanced by bli-4-, let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1882 homozygotes (sterile Unc with withered tail). Homozygous hT2[bli-4 let-? qIs48] normally inviable; occasional recombinants are seen (Bli, bright GFP). Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACTAAGCAATGGTCTCGCA. External right primer: CGACAACAATGGAAACATCG. Internal left primer: CGCTTACGCCTTTTCTATCG. Internal right primer: ACCATTCTCTCGTGAATCCG. Internal WT amplicon: 2136 bp. Deletion size: 764 bp. Deletion left flank: TCGACAACAATGGAGCAATCAAGCTTGCCG. Deletion right flank: CGATAAATAAATTCGCTCTACTTTCATGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1417 T10F2.4(gk647) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T10F2.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk647 homozygotes (sterile with no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACACGTCACCAATGAACGA. External right primer: CGTGGTGTCTCGAATTCCTT. Internal left primer: CATGTCGAAGGACAGGGAGT. Internal right primer: TTCGTTTATGTCCCACGTCA. Internal WT amplicon: 1565 bp. Deletion size: 820 bp. Deletion left flank: ATCAGCAGAAGCAGAGATTGCAGTAATATT. Deletion right flank: GAGACTTGAGAGACGACTGGGTCTTCGGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1421 hmg-1.2(ok1906) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F47D12.4. Homozygous lethal deletion chromosome balanced by bli-4-, let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1906 homozygotes (Dpy, larval arrest). Homozygous hT2[bli-4 let-? qIs48] normally inviable; occasional recombinants are seen (Bli, bright GFP). Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGACTCGCAACCCTCTTCT. External right primer: ATTGTCAACAGAGAACCGGC. Internal left primer: CTATTCGCGTGATCTTGTGC. Internal right primer: ACTTTGGGCTCTTCTGGTGA. Internal WT amplicon: 2101 bp. Deletion size: 759 bp. Deletion left flank: ATTCTGGTTACAGCGCAAACATTTTTCCCA. Deletion right flank: AAAAGAGCCCTGTAAGTTTTTTAAAGTTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1423 ucr-1(ok1909) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F56D2.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1909 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAGCTACGCGCAGGATAAA. External right primer: TTGATGGGCAGACAATCTCA. Internal left primer: TAAACTTTCGGTGGGTCTCG. Internal right primer: TTTCTGGCACAATTCGTCAA. Internal WT amplicon: 2410 bp. Deletion size: 1548 bp. Deletion left flank: ACTCGCCGTCAGCTCTGCTTTGCGTCCGGC. Deletion right flank: AGAACCAATTCAGAACCAACTTGTACCAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1431 K06A5.4(ok1924) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans K06A5.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1924 homozygotes (Dpy, larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGGCAAAATCGTAGGAACAA. External right primer: TTCAACGCCTTCTGAGTTCC. Internal left primer: GCCTAATGGGTGATACGGAA. Internal right primer: TCCTTTGCCTTCGTTTGTTC. Internal WT amplicon: 2805 bp. Deletion size: 2034 bp. Deletion left flank: GCTGAAGCTGAGGCTGAAAGAAGGCGAAAA. Deletion right flank: ATTAGTTTTAAAAAAGCATTAATTTTTCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1439 skr-2(ok1938) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F46A9.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1938 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCAAGCCAAATTGAATGGTT. External right primer: TTCCTTCTTCGTCGTCGAGT. Internal left primer: CGCGACATAAAAATGCACAC. Internal right primer: CACACAAAGGAAGAGACGCA. Internal WT amplicon: 2146 bp. Deletion size: 1107 bp. Deletion left flank: GGTGCACCAAACACCAGTCCGACCCAATTC. Deletion right flank: GTTCTATAACGATCGATAACTCTGCGTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1440 ran-2(ok1939) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C29E4.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1939 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGCAGAATCACTGAAAACG. External right primer: CCCAATCAGTTTCAGCCTGT. Internal left primer: GCTCTTGGAGAGGCATTGAC. Internal right primer: CGGCGGACGATATTTTCTTA. Internal WT amplicon: 2901 bp. Deletion size: 2075 bp. Deletion left flank: GACAAAATAAATCGAGATTGTCTGAAGAAA. Deletion right flank: ACGTGTTATTCTTCAACTTTCAGCACCTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1441 ceh-6(gk665) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans K02B12.1. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk665 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGACAGACGAATGCAACGA. External right primer: GTGCCTTCTTTTTCCAACCA. Internal left primer: ACAGAAGAAAGGGCGGAAAT. Internal right primer: CAACTTCCAACTGCTTTGGG. Internal WT amplicon: 2295 bp. Deletion size: 1525 bp. Deletion left flank: GAAGGTACATTAGTGAATAGGAAAATAATA. Deletion right flank: AGACATTGATGCTGTAGAATTGTGAAGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1459 npp-15(ok1954) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C29E4.4. Homozygous lethal deletion chromosome balanced by bli-4-, let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1954 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] normally inviable; occasional recombinants are seen (Bli, bright GFP). Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGGCTTCCAATTTGACATCG. External right primer: CCACTCGACTTCCACCTTGT. Internal left primer: CATTCATCTTTCGCTGGGTT. Internal right primer: GTCTGCTGGCTTTCCAAGAG. Internal WT amplicon: 3083 bp. Deletion size: 1597 bp. Deletion left flank: ATACCCGGCACTGGTGAAAGAGGCCTTTCT. Deletion right flank: ATGGCAGAGTCGGAAGAGGAATTAAAGGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1463 gon-2(ok465) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T01H8.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok465 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAGAGGTTAAATCAGCCCG. External right primer: GTTGCTGCATTTGGACTTGA. Internal left primer: TGGTGAATAATTGGCTGCAA. Internal right primer: GATGCTTTGGGTTTGTGCTT. Internal WT amplicon: 2829 bp. Deletion size: 507 bp. Deletion left flank: TAATGGTAATCTGACAGAAAACGATTTTTT. Deletion right flank: AGAACTAGAGATATTTTTTGATAAAAACGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1475 tbx-9(gk666) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T07C3.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk666 homozygotes (sterile). Viable fertile non-GFP progeny are recombinants and not homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTGCAGCGACCACTATGAC. External right primer: CAGAATCGATAGCCGAGAGG. Internal left primer: AATTTAATCGGCGGGTCTTC. Internal right primer: TTTGGCAATGAGGTGAGATG. Internal WT amplicon: 2334 bp. Deletion size: 892 bp. Deletion left flank: AGCGTTGTTGGACTCTGAATAGTTGGAGAT. Deletion right flank: GGAGGAGCGGGAAAACTATTCTAACTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1478 vpr-1(tm1411) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F33D11.11. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1411 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTCCGAGATAATACGGCGA. External right primer: ACGCTTGCCTCTAGGCACTA. Internal left primer: TTGGGGGAACGGGGAACCAT. Internal right primer: TAGGCACTAAGCACTGGCCA. Internal WT amplicon: 1799 bp. Deletion size: 657 bp. Deletion left flank: CCTCGTTCCTAACCGCAAAGGTTTTTGTAT. Deletion right flank: TGTTTTTTTTCTATTGGTATTTACGTACAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1497 fum-1(ok1998) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans H14A12.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+ (heterozygotes), arrested hT2 aneuploids, and non-GFP ok1998 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. External left primer: ACTTGTGCGGGAGAAGAGAA. External right primer: CGAATTAAGCTTTCAAGGCG. Internal left primer: GAACCATGCCGAGTTTGATT. Internal right primer: TGAACATTTGGGGACATTGA. Internal WT amplicon: 2152 bp. Deletion size: 1351 bp. Deletion left flank: ACTTTCGGAGAGCTCGAGGTTCCAGCCGAC. Deletion right flank: TGCTCACAAGAACGGCACCACCCTTGTCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1530 mei-1(ok2000) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T01G9.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2000 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATTGTTTGTCGCGGATGA. External right primer: GATGAAGGTGGCCTTGAAAA. Internal left primer: TGTTTCCAACAAGTGAGCCA. Internal right primer: CAAAAACCAAAGCTAGGCCA. Internal WT amplicon: 2180 bp. Deletion size: 1378 bp. Deletion left flank: ACAAAGAAAGGAGTTGGAGCAGCAGGTCCA. Deletion right flank: CAAAGAATGGTGTGACTCTTTTGGTGCCAT. Insertion Sequence: TGTAAATCAACTATTTATTGTGATCTCCTTTTAGTTTAAAATATTGTGGCCTAGCTTTG GGTTTTTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1533 T23D8.3(ok2016) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T23D8.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2016 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGAAGAGCAAGAAGGCGA. External right primer: GGCGCCAATACTTGTTGAAT. Internal left primer: ACACAATTGAGTCGAAGGGG. Internal right primer: CCGGTTCTGTCCAATCAGTT. Internal WT amplicon: 3212 bp. Deletion size: 1434 bp. Deletion left flank: AGGGAATATAAGGAATATTTTGAGACGGGT. Deletion right flank: ATAATTTTCTTGAAGTTTATTTTTCATAAA. Insertion Sequence: ATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1537 isw-1(ok1951) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F37A4.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1951 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTGCTCGATCACGTCAAAC. External right primer: AGAAATCCGGCAAGCATCTA. Internal left primer: TACAGCTTGCCGGAAAAATC. Internal right primer: TAAACGCCCGAGGTAATTTG. Internal WT amplicon: 2817 bp. Deletion size: 1866 bp. Deletion left flank: TTTCTGGGCTTCCGACATACGACCTTGTTG. Deletion right flank: GCGGCGTCGGACGATTCCGGTTCATCGTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1549 pfd-5(gk706) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans R151.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk706 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGGAACTGGTGCTTTTTCG. External right primer: ACATTGCAGGGAAACAAAGG. Internal left primer: ATAGCAGCGAGACAAGCACA. Internal right primer: TTGAATTACCGCCAACAGTG. Internal WT amplicon: 1648 bp. Deletion size: 587 bp. Deletion left flank: TCGCAGTTTGTCACCGGTTGAACTCTCATT. Deletion right flank: CCTGCAGTTGCAATTTTCACATCGTCCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1575 cgh-1(ok492) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C07H6.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok492 homozygotes (sterile adult, tends to explode at vulva). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCAGCTCGAAAATATTGCC. External right primer: GGAAAACCGCAAGGATGGTGG. Internal left primer: TCACGGAGCTAGATGTGACG. Internal right primer: CGTCAAAAAGAACCCGATGT. Internal WT amplicon: 3095 bp. Deletion size: 1043 bp. Deletion left flank: GAGAACATACACAATCTGGACGAGATCACT. Deletion right flank: CCTGGGGTGGCGATGACCAAGTGAACCGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1609 kin-10(ok2031) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T01G9.6. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2031 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTCGCAAAATTTCACGTTT. External right primer: TTCGACAGAAAACTGCTGGA. Internal left primer: GTGACGAAGACAGGCACAAA. Internal right primer: TTCACCCAACCTGTACCCAT. Internal WT amplicon: 2149 bp. Deletion size: 966 bp. Deletion left flank: AGTCGTGTTGTTTTGTGCTGCGGCAACGTT. Deletion right flank: TGGAAGCATTGGCTGATTTTCACAGTAGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1610 T08B2.5(gk721) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T08B2.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk721 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATTTGGTTGAGACGATCCG. External right primer: AAGGTAACATCGCCATCGAC. Internal left primer: CGTGACATGAGATCAGGCAT. Internal right primer: GCTTGTCAAACCTCACGGAT. Internal WT amplicon: 2344 bp. Deletion size: 914 bp. Deletion left flank: GGAATTGTCTACAGTGGATGTATGAACACT. Deletion right flank: GGTTGCCATCAAATTCAAATTTCCAGGGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1621 T26G10.1(ok2057) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans T26G10.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2057 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCACCATCAGCAATATCCA. External right primer: TCCGTTGGACTTTCCAATTC. Internal left primer: TTTTGTCGTCGCTTCTTTCC. Internal right primer: AAGTGTCGTCAGATTGCGTG. Internal WT amplicon: 2101 bp. Deletion size: 1183 bp. Deletion left flank: AGTCGGAAAATTCAAAATCTAACCTAAATT. Deletion right flank: CTCTGAAGACAATTAACCAGTTATTTCAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1622 let-765(ok2058) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F20H11.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2058 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAATCGTATTGCTGCTTCCA. External right primer: CGGAGCTGGTGTAGGAAAAG. Internal left primer: GTCCATTCGAATCTTTCCGA. Internal right primer: TGCTGAACGTGATCTTCGAG. Internal WT amplicon: 3229 bp. Deletion size: 1540 bp. Deletion left flank: CACAGATTCTAGATGAAGTGATAAAATCCG. Deletion right flank: TTTTGAAGTTCTAAGACCATTCGTCCAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1632 C17E4.6(gk787) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C17E4.6. Maternal effect lethal/sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk787 homozygotes (fertile WT whose progeny arrest before reproducing). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTGTGTGAAGAGACGCAGA. External right primer: CCAACCCCAACTGCCTACTA. Internal left primer: AGAGCGCGTTTGCACTAATC. Internal right primer: GGAGCCATAGTCGAGAGACG. Internal WT amplicon: 2178 bp. Deletion size: 796 bp. Deletion left flank: AGAAGGAAGCTCCAATGACGAACATTCAAA. Deletion right flank: ACTGTTTTTGAAGAAACGTTTAAAAAAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1633 unc-120(gk719) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans D1081.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk719 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACTACCTTCACCCCTCCAA. External right primer: CTATAACACGGGACCCCCTT. Internal left primer: GGTCCTTCCATTCCCATCTT. Internal right primer: GGCTGACATAACATCGCTCA. Internal WT amplicon: 2150 bp. Deletion size: 972 bp. Deletion left flank: ATGTTTCTAAAATTTATCTGCATTTTCATA. Deletion right flank: AAATATCCTGACTCACCTATTTAGTTGCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1635 nono-1(gk1206) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans F25B5.7. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1206 homozygotes (Unc, nearly Ste, has a few progeny but can't maintain population). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCCCGTGACGAGATATCAG. External right primer: TCAAATTGCAACTCAACCCA. Internal left primer: AATCGGGAATTGGACACAAC. Internal right primer: TCGCATTATATCGCAGCTTG. Internal WT amplicon: 2308 bp. Deletion size: 1026 bp. Deletion left flank: ACTTCACAAATCAGTGGTTTCGGACTCCTA. Deletion right flank: AAAAGAAAACTCTAGAAGCTTCATAAATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1638 ZK1025.4(ok2101) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans ZK1025.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2101 homozygotes (sterile, lays unfertilized eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTGCTGTTCGGGAAAAAT. External right primer: CAACTTTCCGGCTTGTAGGA. Internal left primer: TTTCCGGGTGAGTGAGTTTC. Internal right primer: GCGTCCGTGAAATTTGAGAT. Internal WT amplicon: 3284 bp. Deletion size: 1617 bp. Deletion left flank: TAAGCTTGGCGTCAGAGGCGAGCGTTAGCT. Deletion right flank: TTTCCGCCAGATCGGCAAATTTGCCGGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1684 C34B2.8(ok2168) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C34B2.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2168 homozygotes (mid-larval arrest, thin Unc sometimes with withered tail). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTTTCATTCCACCTTCGGA. External right primer: CATCTGCTCCAACGACTTCA. Internal left primer: AACAACCGCGTCAAAAGTGT. Internal right primer: ATTCGTCTCGATTTGCTGCT. Internal WT amplicon: 2130 bp. Deletion size: 1250 bp. Deletion left flank: GACCCACCGCTCAATTTTTGTTCCTGCGCC. Deletion right flank: TTGAATGCACGATAGCCTCCTTTTGGAGGC. Insertion Sequence: AAAAGTGCGATGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1685 cogc-1(ok2123) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans Y54E10A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2123 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAATTCGCCAAAAGGGTCT. External right primer: AGCAGAAGCTGGAGCACATT. Internal left primer: CTGACAATTTTTGGGCTCGT. Internal right primer: GCCATCGTTTCTTTGAGAGC. Internal WT amplicon: 3367 bp. Deletion size: approximately 1600 bp. Deletion extents narrowed to region between Y54E10A coordinates 80020 and 81877. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1706 C38H2.2(ok2175) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C38H2.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2175 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGTGCTGGTGATATGGCAA. External right primer: GAAAAGGCACAGGGTGTGAT. Internal left primer: TCAGACAACCTACGACGCTG. Internal right primer: AGGGTGGAGAACAGTCATGG. Internal WT amplicon: 2946 bp. Deletion size: 767 bp. Deletion left flank: GCGAAGAAGGTTCGCGTCTTCTGTTGGATT. Deletion right flank: GGTAATTTCAGATTCATTGAAGTAGCGCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1730 C36B1.8(ok2141) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C36B1.8. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2141 homozygotes (often sterile or nearly sterile, but a population can be maintained and will starve a plate). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAGGACGGCTGTTCCTAAA. External right primer: CATATTGAGCTGGAGTCGCA. Internal left primer: CGAGTACAGAACCGAGGAGG. Internal right primer: ACAATACGCTCTCCGTTTGG. Internal WT amplicon: 3357 bp. Deletion size: 1835 bp. Deletion left flank: TTCTAGCATCTAAATTTTAACAATTAGATT. Deletion right flank: AAATGTATTTTACAACACAATTTCCCTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1732 let-526(gk816) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans C01G8.9. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk816 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. (Note: in this strain hT2[qIs48] occasionally recombines such that the GFP and its associated lethality are lost and the non-GFP hT2 left behind still carries the bli-4 mutation of the original hT2. Such a recombination event results in a viable non-GFP animal that is no longer gk816/hT2[qIs48] but is gk816/hT2.) External left primer: GCCATCACTTTCATCGGATT. External right primer: AATAGACGGCACGTGGAAAC. Internal left primer: ATTCGTTGTTGATAAGCCGC. Internal right primer: ATGACCGATGATGATGACGA. Internal WT amplicon: 1843 bp. Deletion size: 1268 bp. Deletion left flank: AGACATAGACGTCATGCGAAAAATAATATA. Deletion right flank: TCTATATATTCTCCGCGTGGTGGGCTATTT. Insertion Sequence: TATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1733 nekl-2(gk839) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). C. elegans ZC581.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk839 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCGCCCTCTAAATTGTCA. External right primer: GCAGATTTCGTTCCAAGCTC. Internal left primer: TCTTTGTTAGCCATTTCCGC. Internal right primer: GAACAGTCTTTCGGCGATTC. Internal WT amplicon: 1654 bp. Deletion size: 506 bp. Deletion left flank: ATTTCTTGCCGTTTCGTTGAAATTGTTAAC. Deletion right flank: TGTGTTATAATCTACTAACTTTATAATTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807