otEx7121 [inx-3(fosmid WRM0636dA10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.

otIs683 [hlh-4(fosmid)::YFP + ttx-3p::mCherry]. Transgene is expressed in ADL neurons. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979.

otEx7225 [eat-5(fosmid WRM0621dG04)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.

otEx7227 [inx-9(fosmid WRM0632dA04)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.

otEx7232 [inx-15(fosmid WRM0619cH12)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.

otEx7233 [inx-19(extended fosmid WRM0632bE10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.

inx-2(ot906) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-2 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.

otEx7292 [inx-7(fosmid WRM0631dH08)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.

otEx7294 [inx-8(fosmid WRM0632dA04)::SL2::NLS::YFP::H2B + rol-6(su1006)]. Pick Rollers to maintain.

otIs763 [lin-4(fosmid)::NLS::YFP::H2B]. Integrated fosmid transcriptional reporter for lin-4 microRNA.

otIs779 [unc-7(fosmid)::SL2::YFP::H2B + pha-1(+) + myo-2p::BFP]. Derived by integration of otEx7106.

otIs794 [cho-1(fosmid)::NLS::SL2::YFP::H2B + eat-4(fosmid)::SL2::LSSmOrange::H2B + unc-47p::tagBFP2 + cat-1p::mMaroon + rab-3p1::2xNLS::tagRFP]. cho-1 fosmid reporter construct labels cholinergic neurons. eat-4 fosmid reporter construct labels glutamatergic neurons. unc-47p::tagBFP2 reporter (contains -2778 to -1 promoter region) labels GABAergic neurons. cat-1p::mMaroon reporter (contains -1599 to -1) labels monoaminergic neurons. rab-3p::tagRFP (contains -1462 to +2921 of prom1) labels all neurons (pan-neuronal marker). Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

otIs518 [eat-4(fosmid)::SL2::mCherry::H2B + pha-1(+)]. otIs773 [inx-19(fosmid)::SL2::YFP::H2B + unc-122::GFP + pha-1(+)]. Integrated fosmid transcriptional reporter for inx-19.

otEx3401 [unc-14p::hif-1(P621A)::YFP(cDNA) + rol-6(su1006)]. Line 1. Pick Rollers.

otEx3402 [unc-14p::hif-1(P621A)::YFP(cDNA) + rol-6(su1006)]. Line 2. Pick Rollers.

otEx3403 [unc-14p::hif-1(P621A)::YFP(cDNA) + rol-6(su1006)]. Line 3. Pick Rollers.

otEx3398 [unc-14p::hif-1::YFP(cDNA) + rol-6(su1006)]. Line 1. Pick Rollers.

otEx3399 [unc-14p::hif-1::YFP(cDNA) + rol-6(su1006)]. Line 2. Pick Rollers.

otEx3400 [unc-14p::hif-1::YFP(cDNA) + rol-6(su1006)]. Line 3. Pick Rollers.

otEx3909 [ceh-36(fosmid)::YFP + rol-6(su1006)]. otEx3909 is a complex array derived from injection with PvuII-digested E. coli genomic DNA. ceh-36::YFP is broadly expressed in early stage embryos and becomes restricted to ASE and AWC later in development. Pick rollers to maintain.

otIs252 [lsy-6(fosmid)::YFP + rol-6(su1006)]. Rollers. YFP expression in ASEL.

otEx4140 [hlh-3(fosmid)::YFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Reference: Murgan et al. (2015) Developmental Cell 33, 737-745.

otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. otEx4149 [cog-1(fosmid)::YFP + elt-2::DsRed]. Maintain by picking animals dsRed(+) in gut nuclei. Rollers. mCherry expression in ASER and ASEL.

otIs287 [rab-3(prom1)::2xNLS::YFP + rol-6(su1006)] IV. Rollers. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.

otIs291 [rab-3(prom1)::2xNLS::YFP + rol-6(su1006)] V. Rollers. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.

otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. Rollers. mCherry expression in ASER and ASEL. otEx4359 [die-1(prom8)::2NLS::YFP + elt-2::DsRed]. Pick animals with dsRed+ intestinal nuclei to maintain otEx4359. otEx4359 carries a minimal (1 kb) promoter driving 2NLS::YFP only in ASEL.

otIs313 [sem-2(fosmid)::YFP + rol-6(su1006)]. Rollers. Reference: Vidal B, et al. Development. 2015 Jul 15;142(14):2464-77.

pkIs2386 [unc-54p::alpha-synnuclein::YFP + unc-119(+)].

pkIs2386 [unc-54p::alpha-synnuclein::YFP + unc-119(+)].

feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V. rmIs133 [unc-54p::Q40::YFP]. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.

feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V. pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. alphasynuclein::YFP is localized throughout the body-wall muscle cells. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.

feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. alphasynuclein::YFP is localized throughout the body-wall muscle cells. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.

syIs56 [ceh-2::YFP + unc-119(+)] V. Expressed in vulB and vulC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs51 [cdh-3::CFP + unc-119(+)] is expressed in vulC, vulD, vulE and vulF. syIs55 [ceh-2::YFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs101[T04B2.6::YFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs77 [zmp-1::pes-10::YFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs90 [egl-17::yfp + unc-119(+)] III. Expressed in vulC and vulD. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs123[unc-119(+) + fos-1a::YFP-TL]. Integration of functional fos-1a tagged with YFP at the N-terminus. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs118 [fos-1a::YFP-TX + unc-119(+)]. YFP inserted into Sal site seven amino acids down stream of start ATG of Cel-fos-L transcript. YFP from plasmid PPD136.64 (Andy Fire's 1999 kit). Promoter is from nucleotide 529 to 8110 of cosmid F29G9. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs202 [vang-1::YFP + myo-2::DsRed + unc-119(+)]; outcrossing suggests array is integrated in LG V. Reference: Green JL, et al. Cell. 2008 Aug 22;134(4):646-56.

syIs341 [15xUAS::?pes-10::hChR2(Y134R)::YFP::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  channelrhodopsin cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs342 [15xUAS::?pes-10::hChR2(Y134R)::YFP::let-858 3'UTR + ttx-3p::RFP + pBlueScript].  channelrhodopsin cGAL effector.  Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.

syIs605 [15xUAS::iC1-C2-TS::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Chloride-conducting channelrhodopsin cGAL effector.

syIs629 [15xUAS::ChR2(C128s)::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Stable step function ChR2 variant cGAL effector.

syIs635 [15xUAS::hChR2(C128s, D156A)::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Stabilized step function Opsins ChR2 variant cGAL effector.

syIs639 [15xUAS::SwiChR::TS::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Step-Waveform Inhibitory Channelrhodopsin cGAL effector.

zfIs18 [mec-4p::ChR2::YFP + lin-15(+)]. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.

rdIs4 [ehn-3a::Venus + unc-119(+)] X. Expresses Venus (YFP) in Z1/Z4 beginning in embryogenesis and continuing through the L1 larval stage. Reference: Large EE and Mathies LD. G3 (Bethesda). 2014 Mar 20;4(3):471-83.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.