OH15530 |
C. elegans |
pha-1(e2123) III; otEx7225. Show Description
otEx7225 [eat-5(fosmid WRM0621dG04)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
OH15532 |
C. elegans |
pha-1(e2123) III; otEx7227. Show Description
otEx7227 [inx-9(fosmid WRM0632dA04)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
OH15540 |
C. elegans |
pha-1(e2123) III; otEx7232. Show Description
otEx7232 [inx-15(fosmid WRM0619cH12)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
OH15542 |
C. elegans |
pha-1(e2123) III; otEx7233. Show Description
otEx7233 [inx-19(extended fosmid WRM0632bE10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
OH15566 |
C. elegans |
inx-2(ot906 [inx-2::SL2::NLS::yfp::H2B]) X. Show Description
inx-2(ot906) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-2 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
OH15689 |
C. elegans |
pha-1(e2123) III; otEx7292. Show Description
otEx7292 [inx-7(fosmid WRM0631dH08)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
|
|
OH15691 |
C. elegans |
otEx7294. Show Description
otEx7294 [inx-8(fosmid WRM0632dA04)::SL2::NLS::YFP::H2B + rol-6(su1006)]. Pick Rollers to maintain.
|
|
OH16398 |
C. elegans |
otIs763. Show Description
otIs763 [lin-4(fosmid)::NLS::YFP::H2B]. Integrated fosmid transcriptional reporter for lin-4 microRNA.
|
|
OH16765 |
C. elegans |
otIs794. Show Description
otIs794 [cho-1(fosmid)::NLS::SL2::YFP::H2B + eat-4(fosmid)::SL2::LSSmOrange::H2B + unc-47p::tagBFP2 + cat-1p::mMaroon + rab-3p1::2xNLS::tagRFP]. cho-1 fosmid reporter construct labels cholinergic neurons. eat-4 fosmid reporter construct labels glutamatergic neurons. unc-47p::tagBFP2 reporter (contains -2778 to -1 promoter region) labels GABAergic neurons. cat-1p::mMaroon reporter (contains -1599 to -1) labels monoaminergic neurons. rab-3p::tagRFP (contains -1462 to +2921 of prom1) labels all neurons (pan-neuronal marker). Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
OH16848 |
C. elegans |
him-5(e1490)V; otIs518; otIs773. Show Description
otIs518 [eat-4(fosmid)::SL2::mCherry::H2B + pha-1(+)]. otIs773 [inx-19(fosmid)::SL2::YFP::H2B + unc-122::GFP + pha-1(+)]. Integrated fosmid transcriptional reporter for inx-19.
|
|
OH7687 |
C. elegans |
otEx3401. Show Description
otEx3401 [unc-14p::hif-1(P621A)::YFP(cDNA) + rol-6(su1006)]. Line 1. Pick Rollers.
|
|
OH7688 |
C. elegans |
otEx3402. Show Description
otEx3402 [unc-14p::hif-1(P621A)::YFP(cDNA) + rol-6(su1006)]. Line 2. Pick Rollers.
|
|
OH7689 |
C. elegans |
otEx3403. Show Description
otEx3403 [unc-14p::hif-1(P621A)::YFP(cDNA) + rol-6(su1006)]. Line 3. Pick Rollers.
|
|
OH7690 |
C. elegans |
otEx3398. Show Description
otEx3398 [unc-14p::hif-1::YFP(cDNA) + rol-6(su1006)]. Line 1. Pick Rollers.
|
|
OH7691 |
C. elegans |
otEx3399. Show Description
otEx3399 [unc-14p::hif-1::YFP(cDNA) + rol-6(su1006)]. Line 2. Pick Rollers.
|
|
OH7692 |
C. elegans |
otEx3400. Show Description
otEx3400 [unc-14p::hif-1::YFP(cDNA) + rol-6(su1006)]. Line 3. Pick Rollers.
|
|
OH8882 |
C. elegans |
otEx3909. Show Description
otEx3909 [ceh-36(fosmid)::YFP + rol-6(su1006)]. otEx3909 is a complex array derived from injection with PvuII-digested E. coli genomic DNA. ceh-36::YFP is broadly expressed in early stage embryos and becomes restricted to ASE and AWC later in development. Pick rollers to maintain.
|
|
OH8993 |
C. elegans |
otIs252. Show Description
otIs252 [lsy-6(fosmid)::YFP + rol-6(su1006)]. Rollers. YFP expression in ASEL.
|
|
OH9345 |
C. elegans |
otEx4140. Show Description
otEx4140 [hlh-3(fosmid)::YFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Reference: Murgan et al. (2015) Developmental Cell 33, 737-745.
|
|
OH9370 |
C. elegans |
otIs232; otEx4149. Show Description
otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. otEx4149 [cog-1(fosmid)::YFP + elt-2::DsRed]. Maintain by picking animals dsRed(+) in gut nuclei. Rollers. mCherry expression in ASER and ASEL.
|
|
OH9545 |
C. elegans |
otIs287 IV. Show Description
otIs287 [rab-3(prom1)::2xNLS::YFP + rol-6(su1006)] IV. Rollers. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
|
|
OH9609 |
C. elegans |
otIs291 V. Show Description
otIs291 [rab-3(prom1)::2xNLS::YFP + rol-6(su1006)] V. Rollers. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
|
|
OH9838 |
C. elegans |
otIs232; otEx4359. Show Description
otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. Rollers. mCherry expression in ASER and ASEL. otEx4359 [die-1(prom8)::2NLS::YFP + elt-2::DsRed]. Pick animals with dsRed+ intestinal nuclei to maintain otEx4359. otEx4359 carries a minimal (1 kb) promoter driving 2NLS::YFP only in ASEL.
|
|
OH9995 |
C. elegans |
otIs313. Show Description
otIs313 [sem-2(fosmid)::YFP + rol-6(su1006)]. Rollers. Reference: Vidal B, et al. Development. 2015 Jul 15;142(14):2464-77.
|
|
OW13 |
C. elegans |
grk-1(ok1239) X; pkIs2386 IV. Show Description
pkIs2386 [unc-54p::alpha-synnuclein::YFP + unc-119(+)].
|
|
OW15 |
C. elegans |
grk-2(gk268) III; pkIs2386 IV. Show Description
pkIs2386 [unc-54p::alpha-synnuclein::YFP + unc-119(+)].
|
|
PE870 |
C. elegans |
feIs4 V; rmIs133. Show Description
feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V. rmIs133 [unc-54p::Q40::YFP]. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.
|
|
PE871 |
C. elegans |
feIs4 V; pkIs2386. Show Description
feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V. pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. alphasynuclein::YFP is localized throughout the body-wall muscle cells. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.
|
|
PE872 |
C. elegans |
feIs5 X; pkIs2386 Show Description
feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. alphasynuclein::YFP is localized throughout the body-wall muscle cells. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.
|
|
PS3506 |
C. elegans |
syIs56 V. Show Description
syIs56 [ceh-2::YFP + unc-119(+)] V. Expressed in vulB and vulC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS3528 |
C. elegans |
syIs51 V; syIs55 X. Show Description
syIs51 [cdh-3::CFP + unc-119(+)] is expressed in vulC, vulD, vulE and vulF. syIs55 [ceh-2::YFP + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS3722 |
C. elegans |
unc-119(ed4) III; syIs101 IV. Show Description
syIs101[T04B2.6::YFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS3728 |
C. elegans |
syIs77 II. Show Description
syIs77 [zmp-1::pes-10::YFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS3972 |
C. elegans |
unc-119(ed4) syIs90 III. Show Description
syIs90 [egl-17::yfp + unc-119(+)] III. Expressed in vulC and vulD. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS4411 |
C. elegans |
unc-119(ed4) III; syIs123 X. Show Description
syIs123[unc-119(+) + fos-1a::YFP-TL]. Integration of functional fos-1a tagged with YFP at the N-terminus. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS4441 |
C. elegans |
syIs118 I; unc-119(ed4) III. Show Description
syIs118 [fos-1a::YFP-TX + unc-119(+)]. YFP inserted into Sal site seven amino acids down stream of start ATG of Cel-fos-L transcript. YFP from plasmid PPD136.64 (Andy Fire's 1999 kit). Promoter is from nucleotide 529 to 8110 of cosmid F29G9. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS4997 |
C. elegans |
unc-119(e2498) III; syIs179. Show Description
syIs179 [N2 genomic DNA (45 ng/uL) + unc-119(+) (1 ng/uL) + lin-4p::YFP (PCR fusion) (1 ng/uL)(100:1)]. lin-4 promoter primers: GCGATATTTTGCTCGATTCC, ACAGGCCGGAAGCATAAACT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS5647 |
C. elegans |
unc-119(ed4) III; him-5(e1490) V; syIs202. Show Description
syIs202 [vang-1::YFP + myo-2::DsRed + unc-119(+)]; outcrossing suggests array is integrated in LG V. Reference: Green JL, et al. Cell. 2008 Aug 22;134(4):646-56.
|
|
PS7044 |
C. elegans |
syIs341 IV. Show Description
syIs341
[15xUAS::?pes-10::hChR2(Y134R)::YFP::let-858 3'UTR + ttx-3p::RFP + pBlueScript]. channelrhodopsin cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
PS7045 |
C. elegans |
syIs342 II. Show Description
syIs342
[15xUAS::?pes-10::hChR2(Y134R)::YFP::let-858 3'UTR + ttx-3p::RFP + pBlueScript]. channelrhodopsin cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148.
|
|
QW309 |
C. elegans |
zfIs18. Show Description
zfIs18 [mec-4p::ChR2::YFP + lin-15(+)]. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.
|
|
RA446 |
C. elegans |
unc-119(ed3) III; rdIs4 X. Show Description
rdIs4 [ehn-3a::Venus + unc-119(+)] X. Expresses Venus (YFP) in Z1/Z4 beginning in embryogenesis and continuing through the L1 larval stage. Reference: Large EE and Mathies LD. G3 (Bethesda). 2014 Mar 20;4(3):471-83.
|
|
RDV55 |
C. elegans |
rdvIs1 III. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.
|
|
RDV83 |
C. elegans |
rdvIs1 III; zuIs45 V. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.
|
|
RDV84 |
C. elegans |
rdvIs1 III; ddIs6 V. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. ddIs6 [pie-1p::GFP::tbg-1 + unc-119(+)] V. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.
|
|
RM3054 |
C. elegans |
snt-1(md290) II; mdIs126; mdIs129. Show Description
mdIs126 [snt-1p::snt-1(genomic; B-stop)::CFP]. mdIs129 [snt-1p::snt-1(genomic; A-stop)::YFP]. snt-1 mutation in genome is rescued by 2 integrated transgenes. snt-1(genomic; B-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6B; also referred to as "snt-1(A only)." snt-1(genomic; A-stop) = complete snt-1 genomic region with an in-frame stop codon engineered into exon 6A; also referred to as "snt-1(B only)." Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.
|
|
RP1 |
C. elegans |
trIs10. Show Description
trIs10 [myo-3p::MB::YFP + myo-2p::YFP + ceh-23::HcRed + unc-25::DsRed + unc-129nsp::CFP].
|
|
RP247 |
C. elegans |
trIs30. Show Description
trIs30 [him-4p::MB::YFP + hmr-1b::DsRed2 + unc-129nsp::DsRed2].
|
|
SD1913 |
C. elegans |
gaSi300 I; unc-119(ed3) III. Show Description
gaSi300 [rps-0p::YFP-DD + Cbr-unc-119(+)] I. Expresses YFP tagged at the C terminus with a destabilizing domain (ecDHFR, mutated to function at 20C). YFP expression is absent in normal culture conditions, but expressed in the presence of the stabilizing ligand trimethoprim. Reference: Cho U, et al. PLoS One. 2013 Aug 22;8(8):e72393.
|
|
TH65 |
C. elegans |
unc-119(ed3) III; ddIs15. Show Description
ddIs15 [C47B2.3(genomic)::YFP + unc-119(+)]. Alpha tubulin::YFP.
|
|