Defecation motor program defects (Aex), pale and starved-looking, tends to stay still but not Unc.

Superficially wild-type. CRISPR/Cas9 insertion of mKate. Insertion site verified by PCR and sequencing.

Heterozygotes are WT.

sEx10434 [rCes Y46G5A.17::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14858 [rCesY46G5A.30::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

raEx235 [T05G5.1p::Y46G5A.12(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs. Unc worms produce only dead embyros due to strict maternal effect pod-1(ye11) mutation. Embryos from pod-1 homozygous hermaphrodites are osmotically sensitive and exhibit polarity defects.

axIs1486 [pCG51; LAP::Y46G5A.13(tia-1.2) + unc-119(+)]. GFP expression appears in cytoplasmic granules in P1-Z2/Z3 lineages; nuclear & cytoplasmic in other blastomeres. Array is unstable and will silence after several generations. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.

F56D6.15, Y46C8AL.3. Homozygous. Outer Left Sequence: GTTCACATTTTGGTTTGCCC. Outer Right Sequence: TCCATGTTTCAGGGTGCATA. Inner Left Sequence: CAGTTTGCCCGGACAGTAAT. Inner Right Sequence: ATCTTTGAACCCAGCACCTG. Inner Primer PCR Length: 2991 bp. Deletion Size: 4238 bp. Deletion left flank: TTTTTGCTTCACTTATTTCAAACCTCAAGT. Deletion right flank: GTAATAATTTCAGTCCATTGATATGATGCC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3C.1. Homozygous. Outer Left Sequence: GGAATTGAGCATGTCAAGCA. Outer Right Sequence: GGGAATTCACCGAAAATCAA. Inner Left Sequence: TGCCGACATACAACAAGTTCA. Inner Right Sequence: CAAATCGGCAAATCGGTAAT. Inner Primer PCR Length: 1118 bp. Deletion Size: 373 bp. Deletion left flank: AACTCAATTCACAATACTCCTTTTAATTTC. Deletion right flank: ATGGCCACTGTGAGATTGGTACTAGTTAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3C.2 Homozygous. Outer Left Sequence: tttcgtcgctgtagttcgtg. Outer Right Sequence: gggaattcctggccatttac. Inner Left Sequence: gctggcaagcgtcagatac. Inner Right Sequence: cagtggcgagcgttaacata. Inner Primer PCR Length: 1122. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46G5A.19 Homozygous. Outer Left Sequence: taaaccaaattttgccgtcc. Outer Right Sequence: atgcgcctttaatgacttgc. Inner Left Sequence: tcgagttgaaaacgcgagat. Inner Right Sequence: ttgacttttgtttgctcttcttt. Inner Primer PCR Length: 1271. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3C.1 Homozygous. Outer Left Sequence: ggaattgagcatgtcaagca. Outer Right Sequence: gggaattcaccgaaaatcaa. Inner Left Sequence: tgccgacatacaacaagttca. Inner Right Sequence: caaatcggcaaatcggtaat. Inner Primer PCR Length: 1117. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3C.1 Homozygous. Outer Left Sequence: ggaattgagcatgtcaagca. Outer Right Sequence: gggaattcaccgaaaatcaa. Inner Left Sequence: tgccgacatacaacaagttca. Inner Right Sequence: caaatcggcaaatcggtaat. Inner Primer PCR Length: 1117. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46G5A.35 Homozygous. Outer Left Sequence: cttcaggaatcggtttcagc. Outer Right Sequence: agaagccgaagagaaaagcc. Inner Left Sequence: taatctcctcctcagccgtc. Inner Right Sequence: cacatgaagcgtcttcggta. Inner Primer PCR Length: 1314. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46G5A.30. Homozygous. Outer Left Sequence: CGTTACGGCTCTCAGACTCC. Outer Right Sequence: TGCACTGTAACGCTCACCTC. Inner Left Sequence: ATCTTGAAGCGCAAGCTGAT. Inner Right Sequence: GAACTCTGCGTCTCGACTCC. Inner primer WT PCR product: 2878. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46G5A.25. Homozygous. Outer Left Sequence: AACTCTTCTTCTCCGGGCTC. Outer Right Sequence: CACCTGTCTTGGCATTTCCT. Inner Left Sequence: AACGCTTACAATTCCACGCT. Inner Right Sequence: GCAGCATTTATTGTTGCGAA. Inner primer WT PCR product: 2769. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

stIs11763 [Y46G5A.27::H1-wCherry + unc-119(+)].

Y46E12BL.2. Unc. External left primer: ATCCACAATGCTCCGATCTC. External right primer: TCTGGCTTGCTTTTGTGATG. External WT amplicon: 540 bp. This strain contains two point mutations in Y46E12BL.2. The first is gk801, which is a G->A mutation at Y46E12BL coordinate 21938 (flanking sequences GTTCTTGAAGCTATACGGCTTTACACAGAA and TTACTCCAGCCGATCTGGTCACCCGTTATG). The second is gk909, which is an A->G mutation at Y46E12BL coordinate 21966 (flanking sequences AAGTTACTCCAGCCGATCTGGTCACCCGTT and TGTCGATAGTGCGATCGCCAAGTCCAAGGA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3D.7. External left primer: TCTCCGGTCCTTGAAAACTG. External right primer: ATACAAGCCGGGTATTGACG. Internal left primer: GCTCACCGAAATCCCAATAA. Internal right primer: TTGCATGACCAGCAGGAATA. Internal WT amplicon: 1813 bp. Deletion size: 805 bp. Deletion left flank: AAAAATTTCAAAATATTAAGTTTTTAACGT. Deletion right flank: GTAGTTAAAAATTGGCAAACATAGATGCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3D.6. External left primer: TCGAATTGCATTTTGACAGC. External right primer: CGAAAAACAAGCAGCACAAA. Internal left primer: ACACGAATGCATAATTGCCA. Internal right primer: TACCGCCCAGTTTCAAGTTC. Internal WT amplicon: 2013 bp. Deletion size: 1085 bp. Deletion left flank: TCTGGGCTTCACTGATTGGGGTTAACGATT. Deletion right flank: CTTTATTAGACTCAAAGTTGTCTGAAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3D.5. External left primer: TGGACGGTTGAAAACATTGA. External right primer: ACGCCTAGCTCAAAGCAAAA. Internal left primer: TCGCATCAGCTGTTTGATTC. Internal right primer: CGGTCTCAGCTTCTGAGCTT. Internal WT amplicon: 1633 bp. Deletion size: 818 bp. Deletion left flank: AAATTCAGAATATGCCCAACCGAAACTCAC. Deletion right flank: GTTTTGCAAAACCAGCGTCCATCTATTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46C8AL.3. External left primer: AAAAACCCTGACCAAAGGCT. External right primer: AATCGCATGGTTACGCAAAT. Internal left primer: AGACTGACATCCCACAAGCA. Internal right primer: ATTCGGAATCAGGGGAAAAT. Internal WT amplicon: 1151 bp. Deletion size: 507 bp. Deletion left flank: TTCATTGCTTCCAATACACCATCCGGCGGC. Deletion right flank: TGCTAATCTTGATGCTTCCGGTTTCGCTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3A.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3A.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807