| SJ17 |
C. elegans |
xbp-1(zc12) III; zcIs4 V. Show Description
zcIs4 [hsp-4::GFP] V. xbp-1(zc12) animals contain a nonsense mutation at residue 11 in the predicted xbp-1 protein. Animals are unable to induce hsp-4::GFP in response to treatment by tunicamycin or heat shock. |
|
| OP506 |
C. elegans |
unc-119(tm4063) III; wgIs506. Show Description
wgIs506 [xbp-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org) |
|
| RG5003 |
C. elegans |
dxbp-1(gk5666[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5666 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4596 and CGC92. gk5666 is a 2234 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGTGGGCGGCAAAATATTTTTTCCGCCAAACCGGCAAATTGCCGGAATTGAAAATTTCCG. Right flanking sequence: TTCGGAAGTTAAGTGGCATTTGAAGCCGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| RW12180 |
C. elegans |
dxbp-1(st12180[dxbp-1::TY1::EGFP::3xFLAG]) I. Show Description
dxbp-1(st12180[dxbp-1::TY1::EGFP::3xFLAG]) I. |
|
| SZ345 |
C. elegans |
unc-73(e936az30) dxbp-1(az121) I; smg-4(az152) V. Show Description
dxbp-1(az121) is a K23N mutation that promotes usage of introns starting in UU when the sequence GUU is present at the 5' end of the intron. az121 was initially identified as able to suppress uncoordination of unc-73(e936) by promoting a cryptic splice site that defines an intron beginning UU. smg-4 mutant background allows for high throughput sequencing to identify frame shifted transcripts since it can move the 5'ss over by 1nt. e936az30 has no phenotype on its own, but it offers two adjacent cryptic 5'ss separated by 1nt. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478. |
|
| SZ346 |
C. elegans |
prcc-1(az122) IV; smg-4(az152) V. Show Description
az122 is an I371F missense allele of dxbp-1 and presumptive null. It suppresses unc-73(e936) by promoting cryptic splicing of an intron beginning with UU. az122 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). smg-4(az152) provides an NMD deficient background allowing maximization of alternative splicing changes by 1nt by mRNA-Seq. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478. |
|
| SZ355 |
C. elegans |
unc-73(az63) dxbp-1(az52) I; smg-4(az152) V. Show Description
az52 is a CRISPR-engineered M107I missense allele of dxbp-1. az52 has no phenotype on its own, but suppresses unc-73(e936) and unc-73(az63) by promoting use of a cryptic splice site for an intron beginning with UU. smg-4(az152) provides an NMD deficient background allowing identification of out-of-frame mis-splicing in an RNA-seq experiment. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478. |
|
| VC4596 |
C. elegans |
dxbp-1(gk5666[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5003 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2234 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GGTGGGCGGCAAAATATTTTTTCCGCCAAACCGGCAAATTGCCGGAATTGAAAATTTCCG. Right flanking sequence: TTCGGAAGTTAAGTGGCATTTGAAGCCGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| ZD1258 |
C. elegans |
eif-3.L(qd310) II. Show Description
C17G10.9 Increased lifespan and enhanced resistance to endoplasmic reticulum (ER) stress, independent of IRE-1-XBP-1, ATF-6, and PEK-1. Reference: Cattie DJ, et al. PLoS Genet. 2016 Sep 30;12(9):e1006326. |
|
| ZD891 |
C. elegans |
agIs219 III; eif-3.K(qd213) V. Show Description
agIs219 [T24B8.5p::GFP::unc-54-3' UTR + ttx-3p::GFP::unc-54-3' UTR] III. T16G1.11 Increased lifespan and enhanced resistance to endoplasmic reticulum (ER) stress, independent of IRE-1-XBP-1, ATF-6, and PEK-1. Reference: Cattie DJ, et al. PLoS Genet. 2016 Sep 30;12(9):e1006326. |
|
| AGD927 |
C. elegans |
uthIs270. Show Description
uthIs270 [rab-3p::xbp-1s (constitutively active) + myo-2p::tdTomato]. Pick animals with red pharynx to maintain. Reference: Taylor RC, Dillin A. Cell. 2013 Jun 20;153(7):1435-47. |
|