More Fields
Strain Species Genotype
JH3186 C. elegans gtbp-1(ax2039[gtbp-1::3xFlag]) IV. Show Description
Maintain at 20-25C. ax2039 was produced by insertion of 3xFLAG tag at the C-terminus of gtbp-1 by NHEJ. Substitution/insertion of the sequence CTTGTCATCGTCATCCTTGTAATCGATATCATGATCTTTATAATCACCGTCATGGTCTT TGTAGTCCTCCACGAGGAATGCGTGAGGAAATCGTGGA between IV: 10127239...10127269. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3188 C. elegans mex-5(ax2041[3xFLAG::mex-5]) IV. Show Description
Maintain at 20C. 3xFLAG-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3193 C. elegans nos-2(ax2049[3XFLAG::nos-2]) II. Show Description
Maintain at 20C. FLAG::NOS-2 can be detected from P4 to Z2/Z3 stage. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH4008 C. elegans htp-3 (ax3010[htp-3::TEV::eGFP::myc::3Xflag]) I. Show Description
Express tagged htp-3. Reference: Paix A, et al. Genetics. 2015 Sep;201(1):47-54.
JIM173 C. elegans unc-119(tm4063) III; ujEx173. Show Description
ujEx173 [ceh-36::TY1::EGFP::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
JIM193 C. elegans ujIs113 II; ujIs193. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs193 [nhr-67::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0633cC01 by recombineering. Expression of transgene confirmed by GFP.
JIM220 C. elegans ujIs113 II; unc-30(ok613) IV; ceh-36(ok795) X; ujEx173. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
JIM356 C. elegans ujIs113 II; ujIs153. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs153 [ceh-13::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0622c06 by recombineering. Expression of transgene confirmed by GFP.
JJ2286 C. elegans unc-119(ed3) III; zuIs263. Show Description
zuIs263 [myo-3p::myo-3(5' UTR)::npp-9::mCherry::BLRP::3xFLAG::npp-9(3' UTR) + unc-119(+)]. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
JJ2300 C. elegans unc-119(ed3) III; zuIs258; zuIs263. Show Description
zuIs258 [his-72p::his-72(5' UTR)::BIRA::GFP::his-72(3' UTR) + unc-119(+)]. GFP expression detectable in embryos. zuIs263 [myo-3p::myo-3(5' UTR)::npp-9::mCherry::BLRP::3xFLAG::npp-9(3' UTR) + unc-119(+)]. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
JJ2586 C. elegans cox-4(zu476[cox-4::eGFP::3xFLAG]) I. Show Description
cox-4(zu476[cox-4::eGFP::3xFLAG]) I. Endogenous cox-4 locus tagged with eGFP via genome editing. Mitochondria in all cell types are labeled with GFP. Reference: Raiders SA, et al. PLoS Genet. 2018 Jul 19;14(7):e1007417.
JK4871 C. elegans fog-3(q520) I; qSi41 II. Show Description
qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK4942 C. elegans sygl-1(tm5040) I; qSi49 II; unc-119(ed3) III. Show Description
qSi49 [sygl-1p::3xFLAG::sygl-1::sygl-1 3’UTR + unc-119(+)]. Superficially wild-type. Unknown whether or not unc-119(ed3) is still present in the background. Reference: Shin H, et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
JK4996 C. elegans lst-1(ok814) I; qSi69 II; unc-119(ed3) III Show Description
qSi69 [lst-1p::lst-1::3xFLAG::lst-1 3’UTR + unc-119(+)]. Superficially wild-type. Reference: Shin H, et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
JK5028 C. elegans qSi77 II; unc-119(ed3) III. Show Description
qSi77 [mex-5p::eGFP::3xFLAG::tbb-1 3'utr::gpd-2 SL2 splice site::mCherry::3xMyc::pgl-1 RGG repeat::tbb-1 3'utr and intergenic region + unc-119(+)] inserted into ttTi5605 on LG II. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK5200 C. elegans fog-1(q785) fog-3(q520) I; qSi41 II; qSi140 IV. Show Description
qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. qSi140 [3xMyc::fog-1 + unc-119(+)] inserted into cxTi10816 on LG IV. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. qSi140 rescues fog-1 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK5896 C. elegans qSi369 II; unc-119(ed3) III; qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superficially wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. qSi370 can be prone to silencing, especially after severe starvation; silencing of GFP or mCherry expression can occur independently of one another. Maintain by picking animals with bright GFP and mCherry expression. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JK5932 C. elegans sygl-1(q828) I; qSi369 II; qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superfically wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JK5943 C. elegans qSi369 II; glp-1(q224) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+ heterozygotes, non-GFP pharynx q224 homozygotes (Glp sterile at 20-25C) and dead eggs (hT2 homozygotes). All animals are sfGFP + in the germline, with distal and proximal transcription sites in the nucleus. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
KRA467 C. elegans lin-39(kas9[lin-39::mNG::AID]) III. Show Description
mNeonGreen::3xFLAG::AID was inserted at the C-terminus of the endogenous lin-39 locus by CRISPR. Endogenous lin-39 expression marked by mNG. LIN-39 protein can be degraded by Auxin application with expression of TIR-1 protein. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
LP212 C. elegans pkc-3(cp41[mNeonGreen:3xFlag::pkc-3 + LoxP]) II. Show Description
mNG::aPKC endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP216 C. elegans par-6(cp45[par-6::mNeonGreen::3xFlag + LoxP unc-119(+) LoxP]) I; unc-119(ed3) III. Show Description
PAR-6::mNG endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP242 C. elegans par-3(cp54[mNeonGreen::3xFlag::par-3]) III. Show Description
mNG::PAR-3 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP362 C. elegans gex-3(cp114[mNG-C1^3xFlag::gex-3]) IV. Show Description
mNG:GEX-3 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP373 C. elegans mex-5(cp125[mNG-C1^3xFlag::mex-5]) IV. Show Description
mNG::MEX-5 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP393 C. elegans oma-2(cp145[mNG-C1^3xFlag::oma-2]) V. Show Description
mNG::OMA-2 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP399 C. elegans rap-1(cp151[mNG-C1^3xFlag::rap-1]) IV. Show Description
mNG::RAP-1 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP435 C elegans apr-1(cp166[mNG-C1^3xFlag::apr-1]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP439 C elegans nud-2(cp170[nud-2::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP443 C elegans klp-17(cp174[klp-17::mNG-C1^3xFlag]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP447 C elegans klp-7(cp178[klp-7::mNG-C1^3xFlag]) III. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP451 C elegans bicd-1(cp180[mNG-C1^3xFlag::bicd-1]) IV. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP462 C. elegans mrck-1(cp189[mrck-1::GFP::3xFlag]) V. Show Description
cp189[mrck-1::GFP::3xFlag]. GFP inserted at the C terminus of endogenous mrck-1 gene by Cas9-triggered homologous recombination. Floxed selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. GFP expression in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
LP521 C elegans klp-12(cp234[klp-12::mNG-C1^3xFlag]) IV. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP527 C elegans mes-1(cp240[mes-1::mNG-C1^3xFlag] X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP530 C elegans cam-1(cp243[cam-1::mNG-C1^3xFlag]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP538 C. elegans gsk-3(cp251[gsk-3::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP559 C. elegans mom-2(cp267[mom-2::mNG-C1^3xFlag]) V. Show Description
FP fusion. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP560 C elegans dhc-1(cp268[dhc::mNG-C1::3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP563 C elegans dnc-1(cp271[dnc::mNG-C1::3xFlag]) IV. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP585 C elegans lin-5(cp288[lin-5::mNG-C1^3xFlag]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP591 C elegans lis-1(cp294[lis-1::mNG-C1^3xFlag]) III. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP598 C elegans dlg-1(cp301[dlg-1::mNG-C1^3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP600 C elegans klp-4(cp303[klp-4::mNG-C1^3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP604 C elegans klp-8(cp307[klp-8::mNG-C1^3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP608 C elegans klp-20(cp311[klp-20::mNG-C1^3xFlag]) III. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP697 C. elegans mom-5(cp367[mom-5::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP705 C elegans dsh-1(cp375[dsh-1DIX::mNG-C1^3xFlag::PDZ,DEP]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP713 C elegans pry-1(cp383[pry-1::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
MDX44 C. elegans cylc-2(mon2[cylc-2::mNG::3xFLAG) I. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.