More Fields
Strain Species Genotype
JDW740 C. elegans acn-1(wrd285[acn-1::mNG::3xFLAG]) X. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in the first exon of the endogenous acn-1 locus by CRISPR. Will produce a linker::mNG::3xFLAG::linker fusion after the 32nd amino acid. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW742 C. elegans cpg-7(wrd287[cpg-7:::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous cpg-7 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW764 C. elegans col-125(wrd300[col-125::mNG::3xFLAG]) IV. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-125 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW765 C. elegans col-103(wrd301[col-103::mNG::3xFLAG]) IV. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-103 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW766 C. elegans piit-1(wrd302[piit-1::mNG::3xFLAG]) V. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous piit-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW769 C. elegans lon-8(wrd305[lon-8::mNG::3xFLAG]) V. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous lon-8 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW780 C. elegans col-125(wrd300 wrd312[col-125::mScarlet::2xOLLAS]) IV. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous col-125 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd300.
JDW781 C. elegans col-103(wrd301 wrd313[col-103::mScarlet::2xOLLAS]) IV. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous col-103 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd301.
JDW782 C. elegans piit-1(wrd302 wrd314[piit-1::mScarlet::2xOLLAS]) V. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous piit-1 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd302.
JDW783 C. elegans ctsa-1.1(wrd303 wrd315[ctsa-1.1::mScarlet::2xOLLAS]) II. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous ctsa-1.1 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd303.
JDW785 C. elegans lon-8(wrd305 wrd317[lon-8::mScarlet::2xOLLAS]) V. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous lon-8 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd305.
JDW788 C. elegans col-166(wrd319[col-166::mNG::3xFLAG]) X. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally to produce a translational fusion after amino acid 120 in the endogenous col-166 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW794 C. elegans dpy-14(wrd229 wrd325[dpy-4::mScarlet::2xOLLAS) I. Show Description
mScarlet::2xOLLAS tag inserted at the C-terminus of the endogenous dpy-14 locus by CRISPR. Generated by replacing mNG::3xFLAG with mScarlet::2xOLLAS in parental strain JDW651.
JDW802 C. elegans dao-2(wrd328[dao-2::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous dao-2 locus by CRISPR using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW827 C. elegans col-118(wrd343[col-118::mNG::3xFLAG]) IV. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-118 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW828 C. elegans col-13(wrd344[col-13::mNG::3xFLAG]) V. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-13 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW92 C. elegans wrdSi19 nhr-23(kry61[nhr-23::AID*::TEV::3xFLAG]) I; him-5(e1490) V. Show Description
wrdSi19 [mex-5p::TIR1:F2A:mTagBFP2:tbb-2 3'UTR] (I:-5.32). Strain allows germline-specific depletion of NHR-23::AID*LLTEV::3xFLAG using the auxin-inducible degron system. wrdSi19 was made by crossing parental strain KRY87 to JDW83 [wrdSi10 (mex-5p::TIR1:F2A:mTagBFP2:tbb-2 3?UTR+SEC, I:-5.32); him5(e1490) V] and using heatshock to remove the SEC. Reference: Ragle JM, et al. Development. 2020 Nov 27;147(22):dev193862. doi: 10.1242/dev.193862. PMID: 33060131.
JH2932 C. elegans unc-24(e1172) mbk-2(pk1427) IV/nT1[let-?(m435)] (IV;V); ddEx16. Show Description
ddEx16 [pgl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Maintain at 25C to retain transgene expression. Heterozygotes are Unc and segregate Uncs, dead eggs and WT. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3186 C. elegans gtbp-1(ax2039[gtbp-1::3xFlag]) IV. Show Description
Maintain at 20-25C. ax2039 was produced by insertion of 3xFLAG tag at the C-terminus of gtbp-1 by NHEJ. Substitution/insertion of the sequence CTTGTCATCGTCATCCTTGTAATCGATATCATGATCTTTATAATCACCGTCATGGTCTT TGTAGTCCTCCACGAGGAATGCGTGAGGAAATCGTGGA between IV: 10127239...10127269. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3188 C. elegans mex-5(ax2041[3xFLAG::mex-5]) IV. Show Description
Maintain at 20C. 3xFLAG-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3193 C. elegans nos-2(ax2049[3XFLAG::nos-2]) II. Show Description
Maintain at 20C. FLAG::NOS-2 can be detected from P4 to Z2/Z3 stage. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH4008 C. elegans htp-3 (ax3010[htp-3::TEV::eGFP::myc::3Xflag]) I. Show Description
Express tagged htp-3. Reference: Paix A, et al. Genetics. 2015 Sep;201(1):47-54.
JH4072 C. elegans pgl-3(ax4517[pgl-3::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X. Show Description
3xFlag tag inserted at C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)1129–1140. DOI: 10.1038/s41556-022-00940-w.
JH4073 C. elegans pgl-3(ax4516[pgl-3(delta448-693)::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X. Show Description
3xFlag tag inserted at truncated C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)1129–1140. DOI: 10.1038/s41556-022-00940-w.
JIM173 C. elegans unc-119(tm4063) III; ujEx173. Show Description
ujEx173 [ceh-36::TY1::EGFP::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
JIM193 C. elegans ujIs113 II; ujIs193. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs193 [nhr-67::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0633cC01 by recombineering. Expression of transgene confirmed by GFP.
JIM220 C. elegans ujIs113 II; unc-30(ok613) IV; ceh-36(ok795) X; ujEx173. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
JIM356 C. elegans ujIs113 II; ujIs153. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs153 [ceh-13::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0622c06 by recombineering. Expression of transgene confirmed by GFP.
JJ2286 C. elegans unc-119(ed3) III; zuIs263. Show Description
zuIs263 [myo-3p::myo-3(5' UTR)::npp-9::mCherry::BLRP::3xFLAG::npp-9(3' UTR) + unc-119(+)]. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
JJ2300 C. elegans unc-119(ed3) III; zuIs258; zuIs263. Show Description
zuIs258 [his-72p::his-72(5' UTR)::BIRA::GFP::his-72(3' UTR) + unc-119(+)]. GFP expression detectable in embryos. zuIs263 [myo-3p::myo-3(5' UTR)::npp-9::mCherry::BLRP::3xFLAG::npp-9(3' UTR) + unc-119(+)]. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
JJ2586 C. elegans cox-4(zu476[cox-4::eGFP::3xFLAG]) I. Show Description
cox-4(zu476[cox-4::eGFP::3xFLAG]) I. Endogenous cox-4 locus tagged with eGFP via genome editing. Mitochondria in all cell types are labeled with GFP. Reference: Raiders SA, et al. PLoS Genet. 2018 Jul 19;14(7):e1007417.
JK4871 C. elegans fog-3(q520) I; qSi41 II. Show Description
qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK4942 C. elegans sygl-1(tm5040) I; qSi49 II; unc-119(ed3) III. Show Description
qSi49 [sygl-1p::3xFLAG::sygl-1::sygl-1 3’UTR + unc-119(+)]. Superficially wild-type. Unknown whether or not unc-119(ed3) is still present in the background. Reference: Shin H, et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
JK4996 C. elegans lst-1(ok814) I; qSi69 II; unc-119(ed3) III Show Description
qSi69 [lst-1p::lst-1::3xFLAG::lst-1 3’UTR + unc-119(+)]. Superficially wild-type. Reference: Shin H, et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
JK5028 C. elegans qSi77 II; unc-119(ed3) III. Show Description
qSi77 [mex-5p::eGFP::3xFLAG::tbb-1 3'utr::gpd-2 SL2 splice site::mCherry::3xMyc::pgl-1 RGG repeat::tbb-1 3'utr and intergenic region + unc-119(+)] inserted into ttTi5605 on LG II. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK5200 C. elegans fog-1(q785) fog-3(q520) I; qSi41 II; qSi140 IV. Show Description
qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. qSi140 [3xMyc::fog-1 + unc-119(+)] inserted into cxTi10816 on LG IV. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. qSi140 rescues fog-1 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK5758 C. elegans lst-1(q895[lst-1(long)::3xFLAG]) I. Show Description
3xFLAG tag inserted at the C terminus of the endogenous lst-1 locus, after V398 of the long isoform. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205
JK5800 C. elegans qSi364 IV. Show Description
qSi364 [3xFLAG::fbf-2(R7/R8 loop deletion) + unc-119(+)] IV. Single-copy MosSCI insertion into oxTi177 IV. R7/R8 loop deletion removes a critical protein-to-protein interface. qSi364 is phenotypically wild-type on its own, but Mog when crossed into fbf-1(ok91) fbf-2(q704) background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK5810 C. elegans fbf-2(q945[3xFLAG::fbf-2]) II. Show Description
3xFLAG tag inserted at N-terminus of endogenous fbf-2 locus. Generated in N2 background. Reference: Ferdous AS, et al. 2023 May 1;150(9):dev201705. doi: 10.1242/dev.201705. PMID: 37070766.
JK5896 C. elegans qSi369 II; unc-119(ed3) III; qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superficially wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. qSi370 can be prone to silencing, especially after severe starvation; silencing of GFP or mCherry expression can occur independently of one another. Maintain by picking animals with bright GFP and mCherry expression. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JK5932 C. elegans sygl-1(q828) I; qSi369 II; qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superfically wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JK5935 C. elegans fbf-1(ok91) fbf-2(q973[3xFLAG::fbf-2]) II. Show Description
3xFLAG tag inserted at N-terminus of endogenous fbf-2 locus in fbf-1 null background (parental strain JK3022). Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK5942 C. elegans fog-3(q873[fog-3::3xFLAG]) I; qSi375 II. Show Description
q873[fog-3(1-262)::GGS::3xFLAG::fog-3(263 Phe)] I. qSi375 [mex-5p::eGFP::linker::his-58::3xboxb::tbb-2 3’UTR] II. The tethering assay allows this strain to be used for determining FOG-3 levels in different genetic backgrounds. Similar fertility to N2 wild type. Reference: Aoki S, et al. Cell Rep. 2018 Jun.26; 23(13):3769-3775
JK5943 C. elegans qSi369 II; glp-1(q224) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+ heterozygotes, non-GFP pharynx q224 homozygotes (Glp sterile at 20-25C) and dead eggs (hT2 homozygotes). All animals are sfGFP + in the germline, with distal and proximal transcription sites in the nucleus. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JK5984 C. elegans fbf-2(q1011[*q945]) II. Show Description
q1011 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2. Derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK5986 C. elegans fbf-1(ok91) fbf-2(q1023[*q973])/mIn1[mIs14 dpy-10(e128)] II. Show Description
q1023 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2. Derived by modification of parental strain JK5935 fbf-2(q945[3xFLAG::fbf-2]) II. Pick GFP+ t maintain. Homozygous sterile (Mog) mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok91 q1023 homozygotes (sterile Mog). Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6410 C. elegans fbf-2(q1078[*q945]) II. Show Description
q1078 is an engineered insertion of LambdaN peptide near the C-terminus of 3xFLAG-tagged FBF-2. Derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6412 C. elegans fbf-2(q1080[*1011]) II. Show Description
q1080 is an engineered insertion of LambdaN peptide near the C-terminus of 3xFLAG-tagged FBF-2 with a Y479A point mutation in the R7/R8 loop. Derived by modification of parental strain JK5984 fbf-2(q1011[*q945]) II. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6509 C. elegans fbf-1(q1227) fbf-2(q945[3xFLAG::fbf-2])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes. fbf-1(q1227) fbf-2(q945[3xFLAG::fbf-2]) homozygotes are partially sterile, ~50% make excess sperm and delay oogenesis resulting in delayed egg laying when compared to wild-type animals. Pick WT dim GFP and check for correct segregation of progeny to maintain. q1227 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK5810.
JK6510 C. elegans fbf-1(q1228) fbf-2(q1011[*q945])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. q1011 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2 derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. q1228 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK5984.