BC4583 |
C. elegans |
sEx37. Show Description
sEx37 [C06G4 (III) + pCes1943[rol-6(su1006)]]. Cosmid C06G4 and plasmid pCes1943 were injected into hermaphrodite from N2 strain. pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
DCD179 |
C. elegans |
uqEx37. Show Description
uqEx37 [kin-19p::kin-19::Venus + unc-122p::GFP]. Age-dependent aggregation of KIN-19::Venus in pharynx.
|
|
DG3391 |
C. elegans |
acy-4(ok1806) V; tnEx37. Show Description
tnEx37 [acy-4(+) + sur-5::GFP]. Pick GFP+ animals to maintain. tnEx37 rescues acy-4(ok1806) sterility. Reference: Kim S, et al. 2012 Genetics
|
|
EM101 |
C. elegans |
lin-41(bx37) I; him-5(e1490) V. Show Description
Maintain under normal conditions. Males have long tail tips.
|
|
GLW45 |
C. elegans |
ZK1058.9(utx37[ZK1058.9::mNG::3xFlag]) III Show Description
C-terminal tag of ZK1058.9 via CRISPR/Cas9 knock-in of mNeonGreen at ZK1058.9 locus. Insertion verified by PCR and fluorescence. Left flank: 5' AGCTCAACGGCTAGCTGGTCTCGTTATTAT 3' (1 silent mutation); Right flank: 5' TAAtgaattttcctccaacttttgtcctct 3'; sgRNA: AATAACGAGACCAGCTAG (18 bp); Cas9/sgRNA plasmid: pGLOW58; mNG^SEC^3xFlag plasmid: pGLOW68; SEC insertion allele strain: GLW44.
|
|
OS132 |
C. elegans |
nsEx37. Show Description
nsEx37 [cfi-1::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Reference: Shaham S, Bargmann CI. Genes Dev. 2002 Apr 15;16(8):972-83.
|
|
VL4 |
C. elegans |
unc-119(ed3) III; wwEx37. Show Description
wwEx37 [ngn-1::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
VL531 |
C. elegans |
unc-119(ed3) III; wwIs20; wwEx37. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx37 [ngn-1::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
ZZ37 |
C. elegans |
unc-63(x37) I. Show Description
Use as new reference allele. Unc.
|
|
BC5299 |
C. elegans |
sEx374. Show Description
sEx374 [F17C8 (III) + pCes1943[rol-6(su1006)]]. 20 ng/ul F17C8 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC5301 |
C. elegans |
sEx376. Show Description
sEx376 [ZK1290 (II) + pCes1943[rol-6(su1006)]]. 10 ng/ul ZK1290 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC5302 |
C. elegans |
sEx377. Show Description
sEx377 [F43E2 (II) + pCes1943[rol-6(su1006)]]. 20 ng/ul F43E2 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC5303 |
C. elegans |
sEx378. Show Description
sEx378 [C06A8 (II) + pCes1943[rol-6(su1006)]]. 20 ng/ul C06A8 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
CX3709 |
C. elegans |
unc-115(ky275) X. Show Description
Unc. Lon.
|
|
CX3716 |
C. elegans |
lin-15B&lin-15A(n765) kyIs141 X. Show Description
kyIs141[osm-9::GFP5 + lin-15(+)]. GFP in sensory neurons.
|
|
DM7370 |
C. elegans |
pha-1(e2123) III; raEx370. Show Description
raEx370 [T05G5.1p::ZC504.5(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7371 |
C. elegans |
pha-1(e2123) III; raEx371. Show Description
raEx371 [T05G5.1p::C40C9.5(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7372 |
C. elegans |
pha-1(e2123) III; raEx372. Show Description
raEx372 [T05G5.1p::ZK892.1(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7373 |
C. elegans |
pha-1(e2123) III; raEx373. Show Description
raEx373 [T05G5.1p::W05H7.4(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7374 |
C. elegans |
pha-1(e2123) III; raEx374. Show Description
raEx374 [T05G5.1p::ZK54.1(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7375 |
C. elegans |
pha-1(e2123) III; raEx375. Show Description
raEx375 [T05G5.1p::F46F6.2(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7376 |
C. elegans |
pha-1(e2123) III; raEx376. Show Description
raEx376 [T05G5.1p::K08C7.6(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7377 |
C. elegans |
pha-1(e2123) III; raEx377. Show Description
raEx377 [T05G5.1p::F56B6.4(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7378 |
C. elegans |
pha-1(e2123) III; raEx378. Show Description
raEx378 [T05G5.1p::F44G4.4(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7379 |
C. elegans |
pha-1(e2123) III; raEx379. Show Description
raEx379 [T05G5.1p::T12D8.8(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
GR1339 |
C. elegans |
daf-2(e1370) III; mgEx376. Show Description
mgEx376 [unc-14p::daf-2 + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
|
|
GR1340 |
C. elegans |
daf-2(e1370) III; mgEx373. Show Description
mgEx373 [unc-119p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
|
|
GR2107 |
C. elegans |
daf-2(e1370) III; mgEx371. Show Description
mgEx371 [dpy-30p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
|
|
HA759 |
C. elegans |
pqe-1(rt13) III; rtIs11 V. Show Description
rtIs11 [osm-10p::GFP + osm-10p::HtnQ150 + dpy-20(+)]. osm-10 promoter drives expression of both GFP and Htn-Q150 strongly in ASH and more weakly in other neurons of the head and tail. pqe-1(rt13) accelerates Htn-Q150 induced toxicity resulting in ASH neuron cell death predominantly during larval stages. Hence, many adult animals will lack overt GFP expression in ASH neurons. rtEx377 in the original HA759 was selected against leaving only rtIs11 in the strain available at the CGC.
|
|